Incidental Mutation 'R7963:Zwint'
ID613865
Institutional Source Beutler Lab
Gene Symbol Zwint
Ensembl Gene ENSMUSG00000019923
Gene NameZW10 interactor
Synonyms2010007E07Rik, D10Ertd749e, 2600001N01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location72654845-72674964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72657092 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 182 (R182L)
Ref Sequence ENSEMBL: ENSMUSP00000020081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020081] [ENSMUST00000105431] [ENSMUST00000160337] [ENSMUST00000219352]
Predicted Effect probably benign
Transcript: ENSMUST00000020081
AA Change: R182L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020081
Gene: ENSMUSG00000019923
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 8.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105431
AA Change: R182L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101071
Gene: ENSMUSG00000019923
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 8.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160337
AA Change: R182L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124429
Gene: ENSMUSG00000019923
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 4.4e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000219352
AA Change: R126L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Other mutations in Zwint
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zwint APN 10 72657187 critical splice donor site probably null
IGL02334:Zwint APN 10 72654983 splice site probably null
IGL02936:Zwint APN 10 72657124 missense probably damaging 0.98
R0016:Zwint UTSW 10 72657198 unclassified probably benign
R0016:Zwint UTSW 10 72657198 unclassified probably benign
R0365:Zwint UTSW 10 72657295 nonsense probably null
R1628:Zwint UTSW 10 72656295 nonsense probably null
R4405:Zwint UTSW 10 72656263 missense probably damaging 1.00
R4850:Zwint UTSW 10 72655956 unclassified probably benign
R5874:Zwint UTSW 10 72656462 intron probably benign
R6019:Zwint UTSW 10 72656853 missense possibly damaging 0.66
R6181:Zwint UTSW 10 72656599 missense probably benign 0.03
R6333:Zwint UTSW 10 72654952 unclassified probably benign
R7880:Zwint UTSW 10 72657092 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGTGACAAGGTATCTCTGCCTG -3'
(R):5'- CAGCTTATTCTGCAGCGAACAC -3'

Sequencing Primer
(F):5'- ACAAGGTATCTCTGCCTGTCAGTG -3'
(R):5'- TTATTCTGCAGCGAACACAGCAG -3'
Posted On2019-12-27