Incidental Mutation 'R7963:Sema5a'
ID613874
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32686808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1022 (I1022N)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably damaging
Transcript: ENSMUST00000067458
AA Change: I1022N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: I1022N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0413:Sema5a UTSW 15 32669444 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1550:Sema5a UTSW 15 32618849 missense probably benign 0.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2062:Sema5a UTSW 15 32609217 splice site probably benign
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6220:Sema5a UTSW 15 32686729 missense probably damaging 0.99
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32417462 missense probably benign
R7572:Sema5a UTSW 15 32673428 missense probably damaging 1.00
R7621:Sema5a UTSW 15 32609232 missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32682325 missense probably damaging 0.97
R7870:Sema5a UTSW 15 32609339 missense probably benign 0.23
R7880:Sema5a UTSW 15 32686808 missense probably damaging 1.00
R7953:Sema5a UTSW 15 32609339 missense probably benign 0.23
R8025:Sema5a UTSW 15 32548782 missense probably benign 0.37
R8034:Sema5a UTSW 15 32574841 missense probably damaging 1.00
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCCTATTCCACAGAGTTC -3'
(R):5'- AAACCTACACTGTTTGTACTCACC -3'

Sequencing Primer
(F):5'- ATTCCACAGAGTTCAACATGTTCC -3'
(R):5'- TTTGTACTCACCAAAGAATATCCAGC -3'
Posted On2019-12-27