Incidental Mutation 'R7963:Stx5a'
ID613885
Institutional Source Beutler Lab
Gene Symbol Stx5a
Ensembl Gene ENSMUSG00000010110
Gene Namesyntaxin 5A
SynonymsD19Ertd627e, 0610031F24Rik, syntaxin 5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8741413-8756069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8742328 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 19 (G19D)
Ref Sequence ENSEMBL: ENSMUSP00000134854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010254] [ENSMUST00000049424] [ENSMUST00000073430] [ENSMUST00000163172] [ENSMUST00000175872] [ENSMUST00000175901] [ENSMUST00000176013] [ENSMUST00000176314] [ENSMUST00000176381] [ENSMUST00000177322] [ENSMUST00000177373] [ENSMUST00000210512] [ENSMUST00000210592]
Predicted Effect probably damaging
Transcript: ENSMUST00000010254
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049424
SMART Domains Protein: ENSMUSP00000043315
Gene: ENSMUSG00000042729

DomainStartEndE-ValueType
WD40 32 71 9.94e-1 SMART
Blast:WD40 76 113 1e-16 BLAST
WD40 120 159 1.85e0 SMART
Blast:WD40 175 211 2e-16 BLAST
Blast:WD40 214 255 2e-14 BLAST
WD40 258 297 2.8e-3 SMART
low complexity region 326 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073430
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163172
Predicted Effect probably damaging
Transcript: ENSMUST00000175872
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175901
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134951
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176013
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176314
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135348
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176381
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177322
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110
AA Change: G19D

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210512
Predicted Effect probably benign
Transcript: ENSMUST00000210592
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Stx5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03152:Stx5a APN 19 8749774 critical splice donor site probably null
R0541:Stx5a UTSW 19 8749937 missense probably damaging 1.00
R0726:Stx5a UTSW 19 8754911 missense probably damaging 1.00
R1566:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R1990:Stx5a UTSW 19 8748890 critical splice donor site probably null
R2852:Stx5a UTSW 19 8755112 unclassified probably benign
R3022:Stx5a UTSW 19 8755154 unclassified probably benign
R4426:Stx5a UTSW 19 8749740 missense probably benign 0.02
R4684:Stx5a UTSW 19 8743361 missense probably damaging 0.96
R5594:Stx5a UTSW 19 8748465 missense probably damaging 1.00
R5750:Stx5a UTSW 19 8755137 unclassified probably benign
R5929:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R6644:Stx5a UTSW 19 8755248 unclassified probably benign
R6983:Stx5a UTSW 19 8755169 unclassified probably benign
R7242:Stx5a UTSW 19 8755277 missense unknown
R7258:Stx5a UTSW 19 8754907 critical splice acceptor site probably null
R7464:Stx5a UTSW 19 8743504 unclassified probably benign
R7871:Stx5a UTSW 19 8755118 missense unknown
R7880:Stx5a UTSW 19 8742328 missense probably damaging 1.00
R7954:Stx5a UTSW 19 8755118 missense unknown
X0020:Stx5a UTSW 19 8748890 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCAAAGTCTGTCAAATACG -3'
(R):5'- AGCATTAACTAAATGGGCTCACG -3'

Sequencing Primer
(F):5'- TCTGTCAAATACGGGAAAGGGCC -3'
(R):5'- CCAGCTTCTTACCTGACGG -3'
Posted On2019-12-27