Mutagenetix > Incidental Mutation

Incidental Mutation 'R0670:Pkn2'

61390

Institutional Source

Beutler Lab

Gene Symbol

Pkn2

Ensembl Gene

ENSMUSG00000004591

Gene Name

protein kinase N2

Synonyms

PRK2, Stk7, Prkcl2, 6030436C20Rik

MMRRC Submission

038855-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0670 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

142790902-142882004 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 142839343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 23 (I23K)

Ref Sequence

ENSEMBL: ENSMUSP00000134046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]

AlphaFold

Q8BWW9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043812
AA Change: D123E

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: D123E

Domain	Start	End	E-Value	Type
Hr1	47	110	3.61e-20	SMART
Hr1	136	204	6.1e-18	SMART
Hr1	217	285	6.05e-22	SMART
C2	329	462	2.72e-8	SMART
low complexity region	535	546	N/A	INTRINSIC
low complexity region	570	578	N/A	INTRINSIC
S_TKc	656	915	7.94e-100	SMART
S_TK_X	916	980	6.77e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172521

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172916

Predicted Effect

probably benign
Transcript: ENSMUST00000173830
AA Change: D123E

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: D123E

Domain	Start	End	E-Value	Type
Hr1	47	110	3.61e-20	SMART
Hr1	136	204	6.1e-18	SMART
Hr1	217	285	6.05e-22	SMART
low complexity region	364	380	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	522	530	N/A	INTRINSIC
S_TKc	608	867	7.94e-100	SMART
S_TK_X	868	932	6.77e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173913
AA Change: I23K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000174422
AA Change: D123E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: D123E

Domain	Start	End	E-Value	Type
Hr1	47	110	3.61e-20	SMART
Hr1	136	204	6.1e-18	SMART
Hr1	217	285	6.05e-22	SMART
C2	329	446	2.92e-8	SMART
low complexity region	519	530	N/A	INTRINSIC
low complexity region	554	562	N/A	INTRINSIC
S_TKc	640	899	7.94e-100	SMART
S_TK_X	900	964	6.77e-16	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
a	A	T	2: 155,045,758	D46V	probably damaging	Het
Abraxas2	A	T	7: 132,869,031		probably null	Het
Afap1l2	G	A	19: 56,915,803	T684I	probably damaging	Het
Ahcyl1	A	T	3: 107,671,165	V205E	probably damaging	Het
Ap4e1	T	A	2: 127,011,864		probably null	Het
Brms1	C	A	19: 5,045,971	N24K	probably damaging	Het
Celf3	ACAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCA	3: 94,488,230		probably benign	Het
Col25a1	A	G	3: 130,386,895	K130E	possibly damaging	Het
Crisp1	A	C	17: 40,305,110	Y125*	probably null	Het
Dnhd1	A	T	7: 105,696,464	D2272V	possibly damaging	Het
Elmod1	A	G	9: 53,912,822	V294A	probably damaging	Het
Gm8909	G	C	17: 36,168,098	F86L	possibly damaging	Het
Gmfg	T	A	7: 28,441,528	I33K	probably damaging	Het
Gsk3b	G	T	16: 38,144,316	D49Y	probably damaging	Het
Harbi1	C	T	2: 91,712,535	R114W	probably damaging	Het
Hspbp1	A	G	7: 4,677,736	V247A	probably damaging	Het
Kif17	A	T	4: 138,262,499		probably benign	Het
Klhl6	T	A	16: 19,949,559	H412L	possibly damaging	Het
Muc1	A	G	3: 89,230,532	D227G	probably benign	Het
Nat8f5	A	T	6: 85,817,975	M1K	probably null	Het
Neb	A	G	2: 52,256,124	V2947A	possibly damaging	Het
Nfrkb	A	T	9: 31,420,173	Q1295L	probably benign	Het
Otop1	T	C	5: 38,287,948	V150A	possibly damaging	Het
Pcdhb2	A	T	18: 37,296,648	D558V	probably damaging	Het
Pdilt	T	C	7: 119,500,428	K206E	probably benign	Het
Plec	A	T	15: 76,205,960	L60Q	probably damaging	Het
Ranbp2	C	A	10: 58,480,698	D2413E	probably benign	Het
Socs1	A	G	16: 10,784,262	Y204H	probably damaging	Het
Stk39	T	C	2: 68,366,182	D301G	possibly damaging	Het
Tlr5	T	A	1: 182,973,889	W253R	probably damaging	Het
Treml2	A	G	17: 48,307,836		probably null	Het
Ttn	A	G	2: 76,749,104	L22069P	probably damaging	Het
Vps13c	G	T	9: 67,925,857	S1614I	probably benign	Het
Vrk2	C	T	11: 26,486,959		probably null	Het
Xrn1	A	G	9: 95,991,056	Y655C	probably damaging	Het

Other mutations in Pkn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Pkn2	APN	3	142799019	missense	probably damaging	1.00
IGL00852:Pkn2	APN	3	142809816	unclassified	probably benign
IGL00917:Pkn2	APN	3	142853625	missense	probably damaging	1.00
IGL01147:Pkn2	APN	3	142829009	missense	probably benign	0.06
IGL01556:Pkn2	APN	3	142829317	missense	possibly damaging	0.88
IGL01574:Pkn2	APN	3	142839231	missense	possibly damaging	0.48
IGL02058:Pkn2	APN	3	142803663	missense	probably damaging	0.97
IGL02136:Pkn2	APN	3	142853590	missense	probably damaging	1.00
IGL02310:Pkn2	APN	3	142811580	missense	probably damaging	1.00
IGL02540:Pkn2	APN	3	142809704	missense	probably benign	0.01
IGL02607:Pkn2	APN	3	142794101	critical splice donor site	probably null
IGL03256:Pkn2	APN	3	142803550	splice site	probably null
voodoo	UTSW	3	142853538	missense	possibly damaging	0.78
R0001:Pkn2	UTSW	3	142828988	missense	probably benign	0.00
R0048:Pkn2	UTSW	3	142810827	missense	probably damaging	1.00
R0081:Pkn2	UTSW	3	142853582	missense	probably damaging	1.00
R0514:Pkn2	UTSW	3	142810458	missense	possibly damaging	0.76
R0709:Pkn2	UTSW	3	142830520	missense	probably damaging	0.98
R1025:Pkn2	UTSW	3	142821565	critical splice donor site	probably null
R1190:Pkn2	UTSW	3	142811525	critical splice donor site	probably null
R1602:Pkn2	UTSW	3	142853538	missense	possibly damaging	0.78
R1729:Pkn2	UTSW	3	142810701	missense	probably benign	0.00
R1756:Pkn2	UTSW	3	142810727	missense	possibly damaging	0.94
R1764:Pkn2	UTSW	3	142793854	missense	probably damaging	1.00
R1797:Pkn2	UTSW	3	142809528	missense	probably damaging	1.00
R1833:Pkn2	UTSW	3	142821647	missense	probably damaging	1.00
R2035:Pkn2	UTSW	3	142820587	missense	probably damaging	0.99
R2058:Pkn2	UTSW	3	142853471	missense	possibly damaging	0.93
R3779:Pkn2	UTSW	3	142793980	missense	possibly damaging	0.89
R3940:Pkn2	UTSW	3	142793911	missense	probably damaging	1.00
R3967:Pkn2	UTSW	3	142809677	missense	probably damaging	0.98
R4008:Pkn2	UTSW	3	142810458	missense	possibly damaging	0.76
R4160:Pkn2	UTSW	3	142803564	missense	probably benign	0.42
R4222:Pkn2	UTSW	3	142793866	nonsense	probably null
R4243:Pkn2	UTSW	3	142820578	missense	possibly damaging	0.64
R4380:Pkn2	UTSW	3	142830456	unclassified	probably benign
R4826:Pkn2	UTSW	3	142809509	missense	probably damaging	1.00
R4869:Pkn2	UTSW	3	142803618	missense	probably damaging	1.00
R5096:Pkn2	UTSW	3	142839331	missense	probably damaging	0.99
R5175:Pkn2	UTSW	3	142798923	missense	probably damaging	1.00
R5301:Pkn2	UTSW	3	142839206	critical splice donor site	probably null
R5839:Pkn2	UTSW	3	142821529	missense	probably benign	0.02
R6155:Pkn2	UTSW	3	142853693	missense	probably benign	0.00
R6198:Pkn2	UTSW	3	142810404	missense	probably benign	0.00
R6255:Pkn2	UTSW	3	142811599	missense	probably damaging	1.00
R6293:Pkn2	UTSW	3	142809704	missense	probably benign	0.15
R6494:Pkn2	UTSW	3	142803668	missense	possibly damaging	0.94
R6659:Pkn2	UTSW	3	142803587	missense	probably damaging	1.00
R6809:Pkn2	UTSW	3	142799004	missense	probably damaging	1.00
R7267:Pkn2	UTSW	3	142812015	missense	possibly damaging	0.90
R7367:Pkn2	UTSW	3	142810727	missense	probably benign	0.00
R7746:Pkn2	UTSW	3	142794107	missense	probably damaging	1.00
R7940:Pkn2	UTSW	3	142810719	missense	probably benign	0.00
R8324:Pkn2	UTSW	3	142829010	missense	probably benign	0.15
R8847:Pkn2	UTSW	3	142820640	missense	probably benign	0.29
R8947:Pkn2	UTSW	3	142811913	critical splice donor site	probably null
R9096:Pkn2	UTSW	3	142809488	missense	probably benign	0.03
R9097:Pkn2	UTSW	3	142809488	missense	probably benign	0.03
R9130:Pkn2	UTSW	3	142809484	missense	possibly damaging	0.51
R9226:Pkn2	UTSW	3	142793948	missense	probably damaging	1.00
R9267:Pkn2	UTSW	3	142811915	missense	probably null	0.97
R9277:Pkn2	UTSW	3	142810748	missense	probably benign	0.01
R9308:Pkn2	UTSW	3	142811963	missense	probably benign	0.21
R9372:Pkn2	UTSW	3	142829257	missense	probably damaging	0.99
R9551:Pkn2	UTSW	3	142793833	missense	probably damaging	1.00
R9552:Pkn2	UTSW	3	142793833	missense	probably damaging	1.00
R9782:Pkn2	UTSW	3	142810476	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GCAGCTAAAATTGTCTCAGGGTCACTA -3'
(R):5'- TCACTTCTGTGGGGAGTAAGCTGAAT -3'

Sequencing Primer
(F):5'- gaaaacgactcccatttacacc -3'
(R):5'- GTAGTTCTGCAACTCAAGTAGTTCC -3'

Posted On

2013-07-30