Incidental Mutation 'R0670:Pkn2'
ID 61390
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Name protein kinase N2
Synonyms PRK2, Stk7, Prkcl2, 6030436C20Rik
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0670 (G1)
Quality Score 90
Status Not validated
Chromosome 3
Chromosomal Location 142790902-142882004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 142839343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 23 (I23K)
Ref Sequence ENSEMBL: ENSMUSP00000134046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
AlphaFold Q8BWW9
Predicted Effect possibly damaging
Transcript: ENSMUST00000043812
AA Change: D123E

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: D123E

Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172916
Predicted Effect probably benign
Transcript: ENSMUST00000173830
AA Change: D123E

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: D123E

Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173913
AA Change: I23K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000174422
AA Change: D123E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: D123E

Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142799019 missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142809816 unclassified probably benign
IGL00917:Pkn2 APN 3 142853625 missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142829009 missense probably benign 0.06
IGL01556:Pkn2 APN 3 142829317 missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142839231 missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142803663 missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142853590 missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142811580 missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142809704 missense probably benign 0.01
IGL02607:Pkn2 APN 3 142794101 critical splice donor site probably null
IGL03256:Pkn2 APN 3 142803550 splice site probably null
voodoo UTSW 3 142853538 missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142828988 missense probably benign 0.00
R0048:Pkn2 UTSW 3 142810827 missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142853582 missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R0709:Pkn2 UTSW 3 142830520 missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142821565 critical splice donor site probably null
R1190:Pkn2 UTSW 3 142811525 critical splice donor site probably null
R1602:Pkn2 UTSW 3 142853538 missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142810701 missense probably benign 0.00
R1756:Pkn2 UTSW 3 142810727 missense possibly damaging 0.94
R1764:Pkn2 UTSW 3 142793854 missense probably damaging 1.00
R1797:Pkn2 UTSW 3 142809528 missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142821647 missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142820587 missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142853471 missense possibly damaging 0.93
R3779:Pkn2 UTSW 3 142793980 missense possibly damaging 0.89
R3940:Pkn2 UTSW 3 142793911 missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142809677 missense probably damaging 0.98
R4008:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R4160:Pkn2 UTSW 3 142803564 missense probably benign 0.42
R4222:Pkn2 UTSW 3 142793866 nonsense probably null
R4243:Pkn2 UTSW 3 142820578 missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142830456 unclassified probably benign
R4826:Pkn2 UTSW 3 142809509 missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142803618 missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142839331 missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142798923 missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142839206 critical splice donor site probably null
R5839:Pkn2 UTSW 3 142821529 missense probably benign 0.02
R6155:Pkn2 UTSW 3 142853693 missense probably benign 0.00
R6198:Pkn2 UTSW 3 142810404 missense probably benign 0.00
R6255:Pkn2 UTSW 3 142811599 missense probably damaging 1.00
R6293:Pkn2 UTSW 3 142809704 missense probably benign 0.15
R6494:Pkn2 UTSW 3 142803668 missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142803587 missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142799004 missense probably damaging 1.00
R7267:Pkn2 UTSW 3 142812015 missense possibly damaging 0.90
R7367:Pkn2 UTSW 3 142810727 missense probably benign 0.00
R7746:Pkn2 UTSW 3 142794107 missense probably damaging 1.00
R7940:Pkn2 UTSW 3 142810719 missense probably benign 0.00
R8324:Pkn2 UTSW 3 142829010 missense probably benign 0.15
R8847:Pkn2 UTSW 3 142820640 missense probably benign 0.29
R8947:Pkn2 UTSW 3 142811913 critical splice donor site probably null
R9096:Pkn2 UTSW 3 142809488 missense probably benign 0.03
R9097:Pkn2 UTSW 3 142809488 missense probably benign 0.03
R9130:Pkn2 UTSW 3 142809484 missense possibly damaging 0.51
R9226:Pkn2 UTSW 3 142793948 missense probably damaging 1.00
R9267:Pkn2 UTSW 3 142811915 missense probably null 0.97
R9277:Pkn2 UTSW 3 142810748 missense probably benign 0.01
R9308:Pkn2 UTSW 3 142811963 missense probably benign 0.21
R9372:Pkn2 UTSW 3 142829257 missense probably damaging 0.99
R9551:Pkn2 UTSW 3 142793833 missense probably damaging 1.00
R9552:Pkn2 UTSW 3 142793833 missense probably damaging 1.00
R9782:Pkn2 UTSW 3 142810476 missense possibly damaging 0.75
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gaaaacgactcccatttacacc -3'
Posted On 2013-07-30