Incidental Mutation 'R7964:Camta1'
ID613905
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R7964 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 151835876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 18 (S18F)
Ref Sequence ENSEMBL: ENSMUSP00000149268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000153938] [ENSMUST00000169423] [ENSMUST00000214673]
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: S18F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: S18F

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: S18F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: S18F

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153938
AA Change: S18F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134684
Gene: ENSMUSG00000014592
AA Change: S18F

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: S18F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: S18F

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214673
AA Change: S18F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,566 N1030S possibly damaging Het
4930507D05Rik A G 10: 62,449,524 H9R unknown Het
Anks1b T A 10: 90,967,018 S398T probably benign Het
Bbox1 T A 2: 110,292,526 K139N probably benign Het
Birc6 C A 17: 74,641,671 H3047N probably damaging Het
Ccnb1ip1 T C 14: 50,793,820 Y12C possibly damaging Het
Celsr3 G A 9: 108,828,072 A585T probably benign Het
Col6a4 T C 9: 106,080,298 N109S probably benign Het
Crisp4 A T 1: 18,128,669 D180E probably benign Het
D230025D16Rik C A 8: 105,249,452 T347N probably benign Het
Dmxl1 T A 18: 49,864,383 M546K probably damaging Het
Dnah11 C T 12: 117,987,502 V3024I probably benign Het
Dnah2 T C 11: 69,431,238 D3752G probably damaging Het
Dram1 G T 10: 88,324,747 D237E probably benign Het
Ehbp1l1 T C 19: 5,719,398 N626D probably benign Het
Elavl1 T G 8: 4,311,763 N3T probably damaging Het
Fam184a A G 10: 53,698,493 V340A probably benign Het
Fam205a1 C T 4: 42,851,586 C190Y probably benign Het
Fam35a A T 14: 34,267,767 M394K possibly damaging Het
Fer1l5 C T 1: 36,407,036 T876M not run Het
Foxp2 T A 6: 15,409,889 V471E unknown Het
Fstl5 G A 3: 76,536,298 G317R probably damaging Het
Gm30302 A G 13: 49,790,071 S44P possibly damaging Het
Gm32742 T C 9: 51,149,114 E963G possibly damaging Het
Gpbp1 A T 13: 111,439,199 S257T possibly damaging Het
Gsdmc4 C T 15: 63,897,719 C218Y possibly damaging Het
Hmg20b T C 10: 81,346,608 H298R probably damaging Het
Igf2r A T 17: 12,748,704 C72S probably benign Het
Kcnip1 A G 11: 33,633,206 M193T probably damaging Het
Khdc1c G T 1: 21,369,675 C150F probably benign Het
Kmt2b A G 7: 30,579,783 S1485P probably damaging Het
Lnpep A G 17: 17,566,739 S533P probably benign Het
Megf8 T A 7: 25,340,635 V997E possibly damaging Het
Mob2 T C 7: 142,009,440 Y94C probably damaging Het
Npepl1 A G 2: 174,120,594 D351G probably damaging Het
Nrg1 G A 8: 31,838,324 Q213* probably null Het
Nrp2 A G 1: 62,771,831 D677G probably benign Het
Olfr1033 C A 2: 86,041,470 Q52K probably benign Het
Olfr124 G T 17: 37,805,429 G95C probably damaging Het
Olfr143 T A 9: 38,254,110 M228K probably benign Het
Olfr259 G T 2: 87,108,057 T110K probably damaging Het
Olfr679 G T 7: 105,086,573 V286F probably damaging Het
Olfr746 A G 14: 50,653,447 E70G probably damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Prune2 G A 19: 17,123,029 V1966I possibly damaging Het
Ptch2 A G 4: 117,110,388 H751R probably benign Het
Ptges2 T A 2: 32,402,231 M353K probably damaging Het
Pum3 G A 19: 27,396,328 Q564* probably null Het
Qtrt1 A G 9: 21,419,341 D279G probably damaging Het
Rftn1 C T 17: 50,047,435 V300I probably benign Het
Robo2 T C 16: 73,920,697 T1172A probably benign Het
Sdc3 A G 4: 130,816,933 D74G unknown Het
Setd1b A G 5: 123,152,273 M768V unknown Het
Siglech A T 7: 55,772,541 H298L probably benign Het
Sipa1 A T 19: 5,651,676 L977Q probably damaging Het
Slc9c1 G A 16: 45,582,969 V800I probably benign Het
Tbc1d8 C T 1: 39,386,023 R582Q probably damaging Het
Tmem247 T A 17: 86,922,300 F190I probably damaging Het
Trim42 C A 9: 97,363,017 A577S possibly damaging Het
Ubiad1 G A 4: 148,444,269 T61I probably benign Het
Usp40 G A 1: 87,995,713 Q279* probably null Het
Usp48 A G 4: 137,633,455 N733S probably benign Het
Vmn2r83 A T 10: 79,478,427 I170F probably benign Het
Xkr4 G A 1: 3,216,264 P568S probably damaging Het
Zc3h7b T C 15: 81,780,478 W513R probably damaging Het
Zfp40 T C 17: 23,191,466 probably benign Het
Zfp652 T A 11: 95,750,109 S287T possibly damaging Het
Znrf3 G A 11: 5,444,533 A49V unknown Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5388:Camta1 UTSW 4 151075238 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense probably damaging 1.00
R8073:Camta1 UTSW 4 151078824 missense probably damaging 1.00
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense probably benign 0.06
Z1177:Camta1 UTSW 4 151077925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTTATGTTGCCTGAAAGAACC -3'
(R):5'- CACAGATGGCTTTCAGTGGC -3'

Sequencing Primer
(F):5'- TGTTGCCTGAAAGAACCAAGTAACTC -3'
(R):5'- AACCTTGGCATGAGAGTTCC -3'
Posted On2019-12-27