Incidental Mutation 'R0670:Hspbp1'
ID61393
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0670 (G1)
Quality Score182
Status Not validated
Chromosome7
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4677736 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000146248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079970] [ENSMUST00000205952] [ENSMUST00000206306] [ENSMUST00000206946]
Predicted Effect probably damaging
Transcript: ENSMUST00000079970
AA Change: V202A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802
AA Change: V202A

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205952
AA Change: V202A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206306
AA Change: V202A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206946
AA Change: V247A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0568:Hspbp1 UTSW 7 4684432 nonsense probably null
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R3934:Hspbp1 UTSW 7 4664595 missense probably benign 0.41
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6728:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
R7962:Hspbp1 UTSW 7 4681842 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCATCTATCAGCACCATCAGGG -3'
(R):5'- TAAGGAGTAAGCGGTCAGCCTGTG -3'

Sequencing Primer
(F):5'- ACTACTCTGGCTCCTGCAC -3'
(R):5'- TGTCCATAGATTTCTGCCAGC -3'
Posted On2013-07-30