Incidental Mutation 'R7966:Pdgfd'
ID614050
Institutional Source Beutler Lab
Gene Symbol Pdgfd
Ensembl Gene ENSMUSG00000032006
Gene Nameplatelet-derived growth factor, D polypeptide
Synonyms1110003I09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7966 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location6168584-6378850 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 6293939 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
Predicted Effect probably null
Transcript: ENSMUST00000058692
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168039
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000214892
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. This gene product only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cpt1c A T 7: 44,964,014 probably null Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat2 T C 11: 55,253,364 probably null Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Grid1 T G 14: 35,450,302 probably null Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sfxn4 A T 19: 60,858,749 probably null Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc22a16 T G 10: 40,603,664 D577E probably benign Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Syngap1 AACCACCACCACCACCACC AACCACCACCACCACC 17: 26,961,477 probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tkfc A T 19: 10,595,030 probably null Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp2 A G 7: 45,516,764 probably null Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Pdgfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Pdgfd APN 9 6288621 nonsense probably null
IGL00806:Pdgfd APN 9 6288667 missense probably benign 0.00
IGL01481:Pdgfd APN 9 6337271 missense probably null 0.62
IGL01704:Pdgfd APN 9 6337327 missense probably damaging 1.00
IGL02951:Pdgfd APN 9 6288494 missense probably damaging 1.00
IGL03022:Pdgfd APN 9 6288495 missense probably damaging 1.00
R0122:Pdgfd UTSW 9 6293851 missense probably damaging 1.00
R0408:Pdgfd UTSW 9 6293928 nonsense probably null
R0542:Pdgfd UTSW 9 6359769 missense probably damaging 1.00
R0701:Pdgfd UTSW 9 6359706 missense probably damaging 0.98
R1376:Pdgfd UTSW 9 6376994 missense probably benign 0.00
R1376:Pdgfd UTSW 9 6376994 missense probably benign 0.00
R1563:Pdgfd UTSW 9 6293939 critical splice donor site probably null
R2513:Pdgfd UTSW 9 6359894 missense probably damaging 1.00
R3751:Pdgfd UTSW 9 6337447 splice site probably benign
R3831:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3832:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3833:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R4691:Pdgfd UTSW 9 6288556 missense probably damaging 1.00
R6280:Pdgfd UTSW 9 6288627 missense probably benign 0.00
R6622:Pdgfd UTSW 9 6293818 missense probably damaging 1.00
R7488:Pdgfd UTSW 9 6359739 missense probably damaging 1.00
R7581:Pdgfd UTSW 9 6293894 missense probably damaging 1.00
R7873:Pdgfd UTSW 9 6337271 missense probably benign 0.06
R7883:Pdgfd UTSW 9 6293939 critical splice donor site probably null
R7956:Pdgfd UTSW 9 6337271 missense probably benign 0.06
RF009:Pdgfd UTSW 9 6288624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGCAGCTAAAGTCAACTTTAC -3'
(R):5'- CCTTCAAATGTCATGCCCTTAAG -3'

Sequencing Primer
(F):5'- CTCACACTTTAGGTATGACTTTGTG -3'
(R):5'- CAAATGTCATGCCCTTAAGTTTGAC -3'
Posted On2019-12-27