Incidental Mutation 'R7966:Slc22a16'
ID614058
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7966 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40603664 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 577 (D577E)
Ref Sequence ENSEMBL: ENSMUSP00000019978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably benign
Transcript: ENSMUST00000019978
AA Change: D577E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: D577E

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078314
AA Change: D556E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: D556E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A C 19: 28,928,613 S297A probably benign Het
Abcb6 A T 1: 75,178,016 S258R possibly damaging Het
Abcc10 A G 17: 46,307,101 V1082A probably benign Het
Adrb2 A G 18: 62,179,376 V126A probably damaging Het
Apol11a A G 15: 77,516,574 E87G probably damaging Het
Arhgap45 T A 10: 80,027,589 C755* probably null Het
Arl13b A T 16: 62,827,266 I93K probably damaging Het
Aspm A G 1: 139,478,667 K1764R possibly damaging Het
Atp8b5 A G 4: 43,342,471 I381V probably damaging Het
Atxn2 A G 5: 121,802,117 H985R possibly damaging Het
Bms1 G T 6: 118,388,774 N1150K probably benign Het
Camta2 T C 11: 70,675,211 D749G probably damaging Het
Cep152 G A 2: 125,613,058 A274V possibly damaging Het
Chd7 A G 4: 8,826,504 N956S probably damaging Het
Cpt1c A T 7: 44,964,014 probably null Het
Cttn C T 7: 144,445,818 V338I probably benign Het
Dab2ip G A 2: 35,720,206 G811D possibly damaging Het
Dmtf1 T C 5: 9,140,397 T106A probably benign Het
Dync2h1 T C 9: 7,005,566 E3768G possibly damaging Het
Exoc1 T A 5: 76,561,382 D612E probably damaging Het
Fat2 T C 11: 55,253,364 probably null Het
Fat4 G A 3: 38,981,819 E3207K probably damaging Het
Fbxw18 A G 9: 109,688,406 Y410H probably damaging Het
Fgfr3 T A 5: 33,733,891 S518T probably damaging Het
Fzr1 G A 10: 81,368,635 T377M probably damaging Het
Gcnt3 T A 9: 70,034,171 I372F probably damaging Het
Gm10577 A T 4: 101,020,522 Y59N unknown Het
Gm826 A G 2: 160,327,293 L32P unknown Het
Grid1 T G 14: 35,450,302 probably null Het
Hid1 T A 11: 115,354,609 T457S probably damaging Het
Hsd3b5 A G 3: 98,622,140 V58A probably benign Het
Iqcj A G 3: 68,047,308 K49E probably damaging Het
Itpk1 A G 12: 102,606,175 V93A probably benign Het
Kcnt2 A G 1: 140,523,150 I722M probably damaging Het
Klhl36 T C 8: 119,874,478 V412A possibly damaging Het
Krt18 G A 15: 102,028,450 V58M possibly damaging Het
Lats2 T C 14: 57,697,200 Y691C probably damaging Het
Lrp1b A T 2: 40,665,129 I4095N Het
Map1a A G 2: 121,305,372 E2223G probably damaging Het
Med25 A G 7: 44,891,808 F94L possibly damaging Het
Mertk A G 2: 128,776,345 I499V probably benign Het
Mrps12 A G 7: 28,740,143 L49P probably benign Het
Nwd1 T A 8: 72,667,126 V339D probably damaging Het
Obscn G A 11: 59,070,009 Q3159* probably null Het
Patj G A 4: 98,611,135 V1349I probably benign Het
Pcdha8 T A 18: 36,993,143 V226D probably damaging Het
Pdgfd T A 9: 6,293,939 probably null Het
Pdzd7 A C 19: 45,030,240 I600S probably damaging Het
Pgpep1l G A 7: 68,239,149 R45* probably null Het
Pik3c3 T C 18: 30,274,363 S55P probably benign Het
Pkhd1l1 A T 15: 44,529,126 D1619V probably damaging Het
Pkp1 A G 1: 135,884,903 probably null Het
Ppan T A 9: 20,891,481 I311N probably benign Het
Ppih C A 4: 119,310,790 G175W probably damaging Het
Ppp1r8 G T 4: 132,834,715 Q65K probably damaging Het
Psmd5 T A 2: 34,856,512 K351M possibly damaging Het
Pth1r T C 9: 110,731,558 K53R probably benign Het
Ptprn A T 1: 75,262,363 F9L probably damaging Het
Rgl3 T C 9: 21,981,427 I288V probably benign Het
Sds A G 5: 120,479,213 I45V possibly damaging Het
Sfxn4 A T 19: 60,858,749 probably null Het
Sis A T 3: 72,920,996 C1220S possibly damaging Het
Slc25a10 T A 11: 120,494,514 M43K possibly damaging Het
Smpd1 T C 7: 105,556,985 I440T probably damaging Het
St6galnac6 A G 2: 32,614,929 N151S probably benign Het
Syngap1 AACCACCACCACCACCACC AACCACCACCACCACC 17: 26,961,477 probably benign Het
Taf4 G T 2: 179,929,295 L742M probably damaging Het
Tctn1 A G 5: 122,264,312 S20P possibly damaging Het
Tkfc A T 19: 10,595,030 probably null Het
Tmem270 A G 5: 134,902,827 V87A possibly damaging Het
Tpo T C 12: 30,103,170 H395R probably damaging Het
Tufm T C 7: 126,488,942 F206L possibly damaging Het
Tulp2 A G 7: 45,516,764 probably null Het
Tulp3 G A 6: 128,326,844 T264M probably damaging Het
Uqcrc2 A G 7: 120,645,217 D194G possibly damaging Het
Vill C A 9: 119,065,521 C415* probably null Het
Zfp799 A G 17: 32,820,282 C337R probably damaging Het
Zhx2 A G 15: 57,821,874 E213G possibly damaging Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7685:Slc22a16 UTSW 10 40574089 missense possibly damaging 0.73
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
RF004:Slc22a16 UTSW 10 40603646 missense possibly damaging 0.94
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATCAGGTCCGGTACTTCTTATTC -3'
(R):5'- AGAGAAGCTCTGCCTGAAGC -3'

Sequencing Primer
(F):5'- GTCCGGTACTTCTTATTCTCTGAAAG -3'
(R):5'- TGAAGCACCCCTCTCAGTC -3'
Posted On2019-12-27