Incidental Mutation 'R0670:Klhl6'
ID 61407
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Name kelch-like 6
Synonyms
MMRRC Submission 038855-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0670 (G1)
Quality Score 93
Status Not validated
Chromosome 16
Chromosomal Location 19765242-19801766 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19768309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 412 (H412L)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839]
AlphaFold Q6V595
Predicted Effect possibly damaging
Transcript: ENSMUST00000058839
AA Change: H412L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: H412L

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 154,887,678 (GRCm39) D46V probably damaging Het
Abraxas2 A T 7: 132,470,760 (GRCm39) probably null Het
Afap1l2 G A 19: 56,904,235 (GRCm39) T684I probably damaging Het
Ahcyl1 A T 3: 107,578,481 (GRCm39) V205E probably damaging Het
Ap4e1 T A 2: 126,853,784 (GRCm39) probably null Het
Brms1 C A 19: 5,095,999 (GRCm39) N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,395,537 (GRCm39) probably benign Het
Col25a1 A G 3: 130,180,544 (GRCm39) K130E possibly damaging Het
Crisp1 A C 17: 40,616,001 (GRCm39) Y125* probably null Het
Dnhd1 A T 7: 105,345,671 (GRCm39) D2272V possibly damaging Het
Elmod1 A G 9: 53,820,106 (GRCm39) V294A probably damaging Het
Gmfg T A 7: 28,140,953 (GRCm39) I33K probably damaging Het
Gsk3b G T 16: 37,964,678 (GRCm39) D49Y probably damaging Het
H2-T5 G C 17: 36,478,990 (GRCm39) F86L possibly damaging Het
Harbi1 C T 2: 91,542,880 (GRCm39) R114W probably damaging Het
Hspbp1 A G 7: 4,680,735 (GRCm39) V247A probably damaging Het
Kif17 A T 4: 137,989,810 (GRCm39) probably benign Het
Muc1 A G 3: 89,137,839 (GRCm39) D227G probably benign Het
Nat8f5 A T 6: 85,794,957 (GRCm39) M1K probably null Het
Neb A G 2: 52,146,136 (GRCm39) V2947A possibly damaging Het
Nfrkb A T 9: 31,331,469 (GRCm39) Q1295L probably benign Het
Otop1 T C 5: 38,445,292 (GRCm39) V150A possibly damaging Het
Pcdhb2 A T 18: 37,429,701 (GRCm39) D558V probably damaging Het
Pdilt T C 7: 119,099,651 (GRCm39) K206E probably benign Het
Pkn2 A T 3: 142,545,104 (GRCm39) I23K probably damaging Het
Plec A T 15: 76,090,160 (GRCm39) L60Q probably damaging Het
Ranbp2 C A 10: 58,316,520 (GRCm39) D2413E probably benign Het
Socs1 A G 16: 10,602,126 (GRCm39) Y204H probably damaging Het
Stk39 T C 2: 68,196,526 (GRCm39) D301G possibly damaging Het
Tlr5 T A 1: 182,801,454 (GRCm39) W253R probably damaging Het
Treml2 A G 17: 48,614,864 (GRCm39) probably null Het
Ttn A G 2: 76,579,448 (GRCm39) L22069P probably damaging Het
Vps13c G T 9: 67,833,139 (GRCm39) S1614I probably benign Het
Vrk2 C T 11: 26,436,959 (GRCm39) probably null Het
Xrn1 A G 9: 95,873,109 (GRCm39) Y655C probably damaging Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19,775,812 (GRCm39) missense probably benign 0.00
IGL01465:Klhl6 APN 16 19,801,572 (GRCm39) missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19,772,235 (GRCm39) missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19,768,276 (GRCm39) missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19,775,832 (GRCm39) missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19,776,001 (GRCm39) missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19,765,887 (GRCm39) missense probably benign 0.44
Ascension UTSW 16 19,765,848 (GRCm39) missense probably damaging 1.00
besmirched UTSW 16 19,768,197 (GRCm39) splice site probably null
blau UTSW 16 19,775,755 (GRCm39) missense probably damaging 1.00
blossom UTSW 16 19,775,889 (GRCm39) missense probably damaging 1.00
Breech UTSW 16 19,766,984 (GRCm39) missense probably benign 0.43
cerulean UTSW 16 19,775,968 (GRCm39) nonsense probably null
cobalt UTSW 16 19,775,772 (GRCm39) missense probably damaging 1.00
grossbeak UTSW 16 19,768,201 (GRCm39) missense probably null 1.00
heights UTSW 16 19,775,778 (GRCm39) missense probably damaging 0.98
Lazuli UTSW 16 19,775,716 (GRCm39) frame shift probably null
Parula UTSW 16 19,775,793 (GRCm39) missense possibly damaging 0.56
sideways UTSW 16 19,776,018 (GRCm39) missense probably damaging 0.99
torres_del_paine UTSW 16 19,766,877 (GRCm39) missense probably damaging 1.00
turquoise UTSW 16 19,801,546 (GRCm39) missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19,801,639 (GRCm39) missense probably benign
R0265:Klhl6 UTSW 16 19,766,984 (GRCm39) missense probably benign 0.43
R0496:Klhl6 UTSW 16 19,775,716 (GRCm39) frame shift probably null
R0497:Klhl6 UTSW 16 19,775,716 (GRCm39) frame shift probably null
R0540:Klhl6 UTSW 16 19,775,764 (GRCm39) missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19,768,197 (GRCm39) splice site probably null
R0554:Klhl6 UTSW 16 19,772,343 (GRCm39) missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19,775,764 (GRCm39) missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19,766,823 (GRCm39) splice site probably benign
R1477:Klhl6 UTSW 16 19,784,727 (GRCm39) missense probably benign 0.00
R1510:Klhl6 UTSW 16 19,765,848 (GRCm39) missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19,784,832 (GRCm39) missense probably benign
R1747:Klhl6 UTSW 16 19,765,778 (GRCm39) missense probably benign 0.40
R1871:Klhl6 UTSW 16 19,775,793 (GRCm39) missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19,801,572 (GRCm39) missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19,801,681 (GRCm39) missense probably benign
R4466:Klhl6 UTSW 16 19,776,018 (GRCm39) missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19,765,897 (GRCm39) missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19,776,034 (GRCm39) missense probably benign 0.44
R4824:Klhl6 UTSW 16 19,775,778 (GRCm39) missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19,775,889 (GRCm39) missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19,775,783 (GRCm39) missense probably benign 0.07
R5001:Klhl6 UTSW 16 19,765,741 (GRCm39) makesense probably null
R5475:Klhl6 UTSW 16 19,766,877 (GRCm39) missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19,775,968 (GRCm39) nonsense probably null
R5867:Klhl6 UTSW 16 19,801,570 (GRCm39) missense probably benign 0.37
R5910:Klhl6 UTSW 16 19,775,844 (GRCm39) missense probably benign 0.04
R6992:Klhl6 UTSW 16 19,772,337 (GRCm39) missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19,801,633 (GRCm39) missense probably benign 0.00
R7262:Klhl6 UTSW 16 19,801,546 (GRCm39) missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19,775,755 (GRCm39) missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19,775,863 (GRCm39) missense possibly damaging 0.58
R7688:Klhl6 UTSW 16 19,765,881 (GRCm39) missense probably damaging 1.00
R7957:Klhl6 UTSW 16 19,768,201 (GRCm39) missense probably null 1.00
R8319:Klhl6 UTSW 16 19,775,940 (GRCm39) missense possibly damaging 0.74
R8460:Klhl6 UTSW 16 19,775,781 (GRCm39) missense probably damaging 1.00
R8853:Klhl6 UTSW 16 19,765,979 (GRCm39) missense possibly damaging 0.52
R9046:Klhl6 UTSW 16 19,765,803 (GRCm39) missense probably damaging 1.00
R9160:Klhl6 UTSW 16 19,775,772 (GRCm39) missense probably damaging 1.00
Z1176:Klhl6 UTSW 16 19,772,424 (GRCm39) missense probably damaging 1.00
Z1177:Klhl6 UTSW 16 19,801,711 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACCACCACATGCAGTACTTTTG -3'
(R):5'- ATCATCCCAGCCTTTGTGGCAC -3'

Sequencing Primer
(F):5'- ACATGCAGTACTTTTGTTGAAATTAC -3'
(R):5'- CCAGCAAGGCTTCCTACTG -3'
Posted On 2013-07-30