Incidental Mutation 'R0670:Klhl6'
ID61407
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0670 (G1)
Quality Score93
Status Not validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19949559 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 412 (H412L)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058839
AA Change: H412L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: H412L

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blau UTSW 16 19957005 missense probably damaging 1.00
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
turquoise UTSW 16 19982796 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19957113 missense possibly damaging 0.58
R7688:Klhl6 UTSW 16 19947131 missense probably damaging 1.00
Z1176:Klhl6 UTSW 16 19953674 missense probably damaging 1.00
Z1177:Klhl6 UTSW 16 19982961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACCACCACATGCAGTACTTTTG -3'
(R):5'- ATCATCCCAGCCTTTGTGGCAC -3'

Sequencing Primer
(F):5'- ACATGCAGTACTTTTGTTGAAATTAC -3'
(R):5'- CCAGCAAGGCTTCCTACTG -3'
Posted On2013-07-30