Incidental Mutation 'R7968:Bnipl'
ID614152
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene NameBCL2/adenovirus E1B 19kD interacting protein like
SynonymsPP753, BNIPL1, 1700128A13Rik, BNIP-S, BNIPL2, BNIPL, BNIPL-2, BNIPL-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7968 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95241271-95251193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95250240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 23 (S23A)
Ref Sequence ENSEMBL: ENSMUSP00000102813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015855] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000125515] [ENSMUST00000137250]
Predicted Effect probably benign
Transcript: ENSMUST00000015855
SMART Domains Protein: ENSMUSP00000015855
Gene: ENSMUSG00000015711

DomainStartEndE-ValueType
Pfam:DHH 19 181 2.5e-10 PFAM
DHHA2 215 359 1.88e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098871
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107195
AA Change: S23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115
AA Change: S23A

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125515
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137250
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo AT ATTCTCT 5: 14,714,194 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Tenm2 C A 11: 36,139,571 probably null Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vsnl1 T C 12: 11,435,585 probably null Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp160 C G 17: 21,032,729 probably null Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95242734 missense probably damaging 1.00
IGL02089:Bnipl APN 3 95250266 splice site probably benign
IGL02273:Bnipl APN 3 95245775 missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95244139 splice site probably benign
R0524:Bnipl UTSW 3 95249829 missense probably benign 0.27
R1181:Bnipl UTSW 3 95245649 critical splice donor site probably null
R1926:Bnipl UTSW 3 95243043 missense probably damaging 1.00
R2072:Bnipl UTSW 3 95244211 missense probably damaging 1.00
R2126:Bnipl UTSW 3 95245683 missense probably damaging 1.00
R2196:Bnipl UTSW 3 95249870 missense possibly damaging 0.83
R2898:Bnipl UTSW 3 95243049 missense probably benign 0.44
R7781:Bnipl UTSW 3 95244175 missense probably damaging 1.00
R7885:Bnipl UTSW 3 95250240 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTTTAAACACAGACCCC -3'
(R):5'- CTGCTCTGTCAAGTGGGAAG -3'

Sequencing Primer
(F):5'- CTCTTGGAGCTCAGAAGAAGGTGTC -3'
(R):5'- GGGAAAACGCCTGTACACATAGAC -3'
Posted On2019-12-27