Incidental Mutation 'R7968:Prdm2'
ID614154
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7968 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143134570 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 717 (A717T)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably benign
Transcript: ENSMUST00000105778
AA Change: A717T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: A717T

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo AT ATTCTCT 5: 14,714,194 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Tenm2 C A 11: 36,139,571 probably null Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vsnl1 T C 12: 11,435,585 probably null Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp160 C G 17: 21,032,729 probably null Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACAAACTCCACGCTGGTG -3'
(R):5'- AGATTCTGATTCCACGGCAC -3'

Sequencing Primer
(F):5'- ACGCTGGTGAGTCACTACGAC -3'
(R):5'- GGCACCCTCGTGTTCCTTAAG -3'
Posted On2019-12-27