Incidental Mutation 'R7968:Cdon'
ID614169
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R7968 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35456522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 238 (V238I)
Ref Sequence ENSEMBL: ENSMUSP00000045547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000137200] [ENSMUST00000151682] [ENSMUST00000154652]
Predicted Effect probably benign
Transcript: ENSMUST00000042842
AA Change: V238I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: V238I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119129
AA Change: V238I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: V238I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127264
SMART Domains Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 1 51 6.26e-5 SMART
IG_like 18 62 1.06e2 SMART
IGc2 81 134 6.45e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137200
Predicted Effect probably benign
Transcript: ENSMUST00000151682
SMART Domains Protein: ENSMUSP00000119206
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 40 103 1.35e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154652
AA Change: V238I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: V238I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,189,314 L608P probably damaging Het
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo AT ATTCTCT 5: 14,714,194 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Tenm2 C A 11: 36,139,571 probably null Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vsnl1 T C 12: 11,435,585 probably null Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp160 C G 17: 21,032,729 probably null Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGAAGCAGCAGTTCCCC -3'
(R):5'- AGAAAGACCTTACCCAGTACATTG -3'

Sequencing Primer
(F):5'- AGTTCCCCGTGGTGTTCACAG -3'
(R):5'- GACCATGTAAGTGACGTGTTTCAC -3'
Posted On2019-12-27