Incidental Mutation 'R0671:Mga'
ID 61418
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms Mga, C130042M01Rik, Mad5, D030062C11Rik
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R0671 (G1)
Quality Score 109
Status Validated
Chromosome 2
Chromosomal Location 119727709-119800062 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 119750391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000110774] [ENSMUST00000156510] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000046717
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000046717
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079934
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079934
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110773
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110773
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110774
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110774
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141776
Predicted Effect probably null
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150742
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119,750,295 (GRCm39) missense possibly damaging 0.65
IGL00719:Mga APN 2 119,777,934 (GRCm39) nonsense probably null
IGL01619:Mga APN 2 119,762,309 (GRCm39) missense possibly damaging 0.46
IGL01721:Mga APN 2 119,765,720 (GRCm39) missense probably damaging 1.00
IGL01759:Mga APN 2 119,781,676 (GRCm39) missense possibly damaging 0.92
IGL01785:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01786:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01950:Mga APN 2 119,772,135 (GRCm39) missense possibly damaging 0.60
IGL01960:Mga APN 2 119,769,138 (GRCm39) missense probably damaging 1.00
IGL02086:Mga APN 2 119,754,517 (GRCm39) missense probably damaging 0.99
IGL02364:Mga APN 2 119,794,535 (GRCm39) missense possibly damaging 0.66
IGL02602:Mga APN 2 119,762,365 (GRCm39) missense possibly damaging 0.66
IGL02751:Mga APN 2 119,778,251 (GRCm39) missense possibly damaging 0.82
IGL02794:Mga APN 2 119,776,770 (GRCm39) missense possibly damaging 0.84
IGL03247:Mga APN 2 119,765,994 (GRCm39) missense possibly damaging 0.81
IGL03303:Mga APN 2 119,733,933 (GRCm39) missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119,746,985 (GRCm39) missense probably damaging 1.00
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0417:Mga UTSW 2 119,733,271 (GRCm39) missense probably damaging 0.99
R0449:Mga UTSW 2 119,771,862 (GRCm39) missense probably damaging 1.00
R0457:Mga UTSW 2 119,746,969 (GRCm39) missense probably damaging 0.98
R0538:Mga UTSW 2 119,750,187 (GRCm39) critical splice donor site probably null
R0568:Mga UTSW 2 119,765,903 (GRCm39) missense probably damaging 1.00
R0614:Mga UTSW 2 119,794,947 (GRCm39) missense probably damaging 1.00
R0811:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0812:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0948:Mga UTSW 2 119,772,140 (GRCm39) missense possibly damaging 0.77
R1177:Mga UTSW 2 119,756,927 (GRCm39) missense probably damaging 1.00
R1445:Mga UTSW 2 119,733,179 (GRCm39) missense probably damaging 1.00
R1476:Mga UTSW 2 119,772,156 (GRCm39) missense probably damaging 0.96
R1527:Mga UTSW 2 119,747,078 (GRCm39) missense probably damaging 1.00
R1583:Mga UTSW 2 119,794,441 (GRCm39) missense possibly damaging 0.66
R1592:Mga UTSW 2 119,795,147 (GRCm39) missense possibly damaging 0.93
R1627:Mga UTSW 2 119,795,043 (GRCm39) missense probably damaging 1.00
R1658:Mga UTSW 2 119,772,170 (GRCm39) missense possibly damaging 0.63
R1677:Mga UTSW 2 119,791,333 (GRCm39) missense possibly damaging 0.92
R1887:Mga UTSW 2 119,754,098 (GRCm39) missense probably damaging 1.00
R1908:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R1909:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R2061:Mga UTSW 2 119,795,461 (GRCm39) unclassified probably benign
R2145:Mga UTSW 2 119,794,638 (GRCm39) missense possibly damaging 0.85
R2159:Mga UTSW 2 119,750,124 (GRCm39) missense probably damaging 0.96
R2179:Mga UTSW 2 119,790,923 (GRCm39) missense probably damaging 0.99
R2281:Mga UTSW 2 119,734,204 (GRCm39) missense probably benign
R2423:Mga UTSW 2 119,795,274 (GRCm39) missense probably damaging 1.00
R3620:Mga UTSW 2 119,747,149 (GRCm39) missense probably damaging 1.00
R3622:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3624:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3802:Mga UTSW 2 119,777,820 (GRCm39) missense probably damaging 0.96
R4011:Mga UTSW 2 119,762,261 (GRCm39) missense probably damaging 1.00
R4065:Mga UTSW 2 119,777,483 (GRCm39) missense probably damaging 1.00
R4520:Mga UTSW 2 119,778,579 (GRCm39) missense possibly damaging 0.85
R4649:Mga UTSW 2 119,771,974 (GRCm39) missense possibly damaging 0.81
R4660:Mga UTSW 2 119,769,104 (GRCm39) intron probably benign
R4757:Mga UTSW 2 119,734,120 (GRCm39) missense possibly damaging 0.82
R4771:Mga UTSW 2 119,794,775 (GRCm39) missense probably damaging 1.00
R4784:Mga UTSW 2 119,733,538 (GRCm39) missense probably damaging 1.00
R4866:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4900:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4952:Mga UTSW 2 119,733,782 (GRCm39) missense probably damaging 1.00
R4995:Mga UTSW 2 119,763,063 (GRCm39) nonsense probably null
R5020:Mga UTSW 2 119,781,654 (GRCm39) nonsense probably null
R5082:Mga UTSW 2 119,733,825 (GRCm39) missense probably damaging 0.98
R5208:Mga UTSW 2 119,778,462 (GRCm39) missense possibly damaging 0.83
R5454:Mga UTSW 2 119,733,810 (GRCm39) missense probably damaging 0.99
R5466:Mga UTSW 2 119,733,178 (GRCm39) missense probably damaging 1.00
R5484:Mga UTSW 2 119,747,107 (GRCm39) missense possibly damaging 0.58
R5669:Mga UTSW 2 119,733,907 (GRCm39) missense probably damaging 1.00
R5819:Mga UTSW 2 119,771,744 (GRCm39) missense possibly damaging 0.61
R5916:Mga UTSW 2 119,794,793 (GRCm39) missense probably benign 0.27
R5942:Mga UTSW 2 119,777,440 (GRCm39) missense probably benign 0.41
R6305:Mga UTSW 2 119,778,179 (GRCm39) missense probably benign 0.00
R6434:Mga UTSW 2 119,754,419 (GRCm39) missense probably damaging 0.99
R6467:Mga UTSW 2 119,776,776 (GRCm39) missense probably damaging 1.00
R6488:Mga UTSW 2 119,791,388 (GRCm39) missense probably damaging 1.00
R6630:Mga UTSW 2 119,754,140 (GRCm39) missense probably damaging 0.99
R6790:Mga UTSW 2 119,754,235 (GRCm39) missense probably damaging 0.99
R7029:Mga UTSW 2 119,754,031 (GRCm39) missense probably damaging 1.00
R7039:Mga UTSW 2 119,763,159 (GRCm39) missense probably benign 0.28
R7088:Mga UTSW 2 119,792,417 (GRCm39) missense probably damaging 1.00
R7195:Mga UTSW 2 119,747,809 (GRCm39) missense probably damaging 1.00
R7273:Mga UTSW 2 119,765,695 (GRCm39) missense probably damaging 1.00
R7286:Mga UTSW 2 119,795,269 (GRCm39) missense possibly damaging 0.93
R7346:Mga UTSW 2 119,766,008 (GRCm39) missense possibly damaging 0.56
R7383:Mga UTSW 2 119,790,821 (GRCm39) missense probably damaging 0.99
R7469:Mga UTSW 2 119,733,527 (GRCm39) missense probably damaging 1.00
R7484:Mga UTSW 2 119,776,710 (GRCm39) missense probably damaging 0.99
R7537:Mga UTSW 2 119,766,032 (GRCm39) missense probably damaging 0.97
R7781:Mga UTSW 2 119,747,838 (GRCm39) missense probably damaging 1.00
R7921:Mga UTSW 2 119,750,159 (GRCm39) missense probably damaging 1.00
R8165:Mga UTSW 2 119,777,719 (GRCm39) missense probably benign 0.12
R8226:Mga UTSW 2 119,790,866 (GRCm39) missense probably benign 0.33
R8305:Mga UTSW 2 119,776,800 (GRCm39) missense possibly damaging 0.77
R8309:Mga UTSW 2 119,791,411 (GRCm39) missense probably damaging 1.00
R8363:Mga UTSW 2 119,794,407 (GRCm39) missense probably benign 0.43
R8388:Mga UTSW 2 119,794,562 (GRCm39) missense probably benign 0.00
R8524:Mga UTSW 2 119,771,997 (GRCm39) missense probably damaging 0.97
R8693:Mga UTSW 2 119,794,407 (GRCm39) missense possibly damaging 0.65
R8837:Mga UTSW 2 119,769,272 (GRCm39) splice site probably benign
R8916:Mga UTSW 2 119,788,819 (GRCm39) missense possibly damaging 0.92
R8936:Mga UTSW 2 119,794,709 (GRCm39) missense probably damaging 1.00
R9028:Mga UTSW 2 119,778,070 (GRCm39) missense probably benign
R9145:Mga UTSW 2 119,794,493 (GRCm39) missense probably benign
R9155:Mga UTSW 2 119,757,013 (GRCm39) missense probably damaging 1.00
R9308:Mga UTSW 2 119,754,369 (GRCm39) missense possibly damaging 0.91
R9342:Mga UTSW 2 119,778,656 (GRCm39) missense probably benign
R9347:Mga UTSW 2 119,733,518 (GRCm39) missense probably damaging 1.00
R9390:Mga UTSW 2 119,794,332 (GRCm39) missense probably damaging 0.99
R9408:Mga UTSW 2 119,765,999 (GRCm39) missense possibly damaging 0.92
R9488:Mga UTSW 2 119,795,304 (GRCm39) missense possibly damaging 0.90
R9495:Mga UTSW 2 119,781,676 (GRCm39) missense possibly damaging 0.92
R9521:Mga UTSW 2 119,794,979 (GRCm39) missense probably damaging 0.99
R9780:Mga UTSW 2 119,747,253 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGAGGCTCTTGATATTCATGCAGTTGA -3'
(R):5'- AGGTCTTTCACTGAACCTAGAACATCCT -3'

Sequencing Primer
(F):5'- ACAGAAGAACCTTCTAGTCTTCAG -3'
(R):5'- gccatctcttcagcccc -3'
Posted On 2013-07-30