Incidental Mutation 'R7968:3110002H16Rik'
ID614197
Institutional Source Beutler Lab
Gene Symbol 3110002H16Rik
Ensembl Gene ENSMUSG00000024410
Gene NameRIKEN cDNA 3110002H16 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R7968 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12168717-12189997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12189314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 608 (L608P)
Ref Sequence ENSEMBL: ENSMUSP00000025276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000025279] [ENSMUST00000134046] [ENSMUST00000138866]
Predicted Effect probably damaging
Transcript: ENSMUST00000025276
AA Change: L608P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410
AA Change: L608P

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025279
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134046
SMART Domains Protein: ENSMUSP00000118783
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138866
SMART Domains Protein: ENSMUSP00000121414
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,295,708 V649A possibly damaging Het
Arglu1 C T 8: 8,667,337 R244H possibly damaging Het
Asic5 A T 3: 82,006,505 Y204F probably benign Het
Asz1 A G 6: 18,104,877 F76S probably damaging Het
Bin1 G A 18: 32,419,843 A174T probably damaging Het
Bnipl A C 3: 95,250,240 S23A probably benign Het
Cd19 T C 7: 126,412,131 T294A probably benign Het
Cdon G A 9: 35,456,522 V238I probably benign Het
Chd3 A T 11: 69,356,625 D957E probably benign Het
Crhbp T C 13: 95,432,007 Q307R probably damaging Het
Cst3 A G 2: 148,872,821 M112T probably benign Het
Dgkb A G 12: 38,139,426 E276G probably damaging Het
Exoc4 T A 6: 33,758,066 N539K probably benign Het
Gm3099 A G 14: 3,999,461 E85G probably benign Het
Gpatch2 A G 1: 187,225,501 probably null Het
Hs3st5 T A 10: 36,828,780 Y26* probably null Het
Hspg2 A T 4: 137,516,837 D802V probably damaging Het
Ifih1 A G 2: 62,601,469 V846A possibly damaging Het
Lama4 T A 10: 39,088,844 S1402T probably benign Het
Lrmda A G 14: 22,598,320 T73A unknown Het
Lrrc1 A T 9: 77,442,189 V365E probably damaging Het
Lrrc37a T A 11: 103,503,042 Q519L probably benign Het
Mlc1 G T 15: 88,977,904 D36E probably benign Het
Mrc2 A T 11: 105,332,266 D445V probably damaging Het
Muc16 A G 9: 18,639,464 S5178P probably benign Het
Nbea A G 3: 55,665,689 I2491T probably damaging Het
Ncoa1 A G 12: 4,339,044 I77T probably damaging Het
Npepps G T 11: 97,218,648 H701N probably damaging Het
Olfr733 T G 14: 50,298,584 T242P probably damaging Het
Olfr837 A T 9: 19,137,535 I181F possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Pclo AT ATTCTCT 5: 14,714,194 probably null Het
Pi4kb T C 3: 94,999,076 Y645H probably damaging Het
Pik3r5 C T 11: 68,492,702 A449V possibly damaging Het
Plat A G 8: 22,771,720 T45A probably benign Het
Platr25 T C 13: 62,700,862 K62R possibly damaging Het
Ppp5c A G 7: 17,006,186 V410A possibly damaging Het
Prdm2 C T 4: 143,134,570 A717T probably benign Het
Ptpn12 A C 5: 20,998,525 S418R possibly damaging Het
Rint1 A G 5: 23,805,644 S255G probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Stab2 T C 10: 86,878,912 H1581R probably benign Het
Stau2 T C 1: 16,460,353 Y114C unknown Het
Tenm2 C A 11: 36,139,571 probably null Het
Ticam1 T C 17: 56,271,067 T343A probably benign Het
Tmem131l T C 3: 83,910,417 K1259E possibly damaging Het
Ugt3a1 A G 15: 9,310,583 N317S possibly damaging Het
Vmn2r103 T A 17: 19,793,123 F169I probably benign Het
Vps33a T C 5: 123,535,249 K425E possibly damaging Het
Vsnl1 T C 12: 11,435,585 probably null Het
Vwa8 T C 14: 79,020,649 M746T probably benign Het
Zc3hav1 A G 6: 38,336,663 I149T possibly damaging Het
Zfp160 C G 17: 21,032,729 probably null Het
Zfp708 A T 13: 67,074,129 D62E probably benign Het
Other mutations in 3110002H16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:3110002H16Rik APN 18 12179219 missense probably benign 0.00
IGL01883:3110002H16Rik APN 18 12178239 missense probably benign 0.03
IGL01956:3110002H16Rik APN 18 12189350 missense probably damaging 0.99
IGL02828:3110002H16Rik APN 18 12189221 missense possibly damaging 0.52
IGL03147:3110002H16Rik APN 18 12169229 splice site probably benign
R0147:3110002H16Rik UTSW 18 12189271 missense probably damaging 0.99
R0357:3110002H16Rik UTSW 18 12179209 missense possibly damaging 0.87
R1108:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1422:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1939:3110002H16Rik UTSW 18 12180505 missense probably damaging 1.00
R4300:3110002H16Rik UTSW 18 12188862 missense probably benign 0.00
R4826:3110002H16Rik UTSW 18 12185779 intron probably benign
R5103:3110002H16Rik UTSW 18 12189262 missense probably benign
R5345:3110002H16Rik UTSW 18 12179177 missense probably benign
R5506:3110002H16Rik UTSW 18 12188956 unclassified probably benign
R5566:3110002H16Rik UTSW 18 12180692 missense possibly damaging 0.90
R5574:3110002H16Rik UTSW 18 12185006 frame shift probably null
R5632:3110002H16Rik UTSW 18 12171583 missense possibly damaging 0.63
R6331:3110002H16Rik UTSW 18 12180514 missense probably damaging 0.99
R6765:3110002H16Rik UTSW 18 12176146 missense possibly damaging 0.82
R6978:3110002H16Rik UTSW 18 12185747 missense probably benign
R7310:3110002H16Rik UTSW 18 12184915 missense probably benign 0.13
R7734:3110002H16Rik UTSW 18 12189263 missense possibly damaging 0.81
R7792:3110002H16Rik UTSW 18 12181599 missense probably damaging 1.00
R7830:3110002H16Rik UTSW 18 12168871 missense probably benign 0.16
R7885:3110002H16Rik UTSW 18 12189314 missense probably damaging 1.00
R8047:3110002H16Rik UTSW 18 12180529 missense possibly damaging 0.67
X0062:3110002H16Rik UTSW 18 12179519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTCCTTCCCGTGGTTG -3'
(R):5'- CAAATGCTTCTCCACCATGTG -3'

Sequencing Primer
(F):5'- CCGTGGTTGCCCTTACC -3'
(R):5'- CACTCCTGTTCTGATTCTATAGAGAG -3'
Posted On2019-12-27