Incidental Mutation 'R7969:Olfr847'
ID614225
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7969 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 19375906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect probably benign
Transcript: ENSMUST00000079620
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216839
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Ccdc51 G T 9: 109,091,587 A181S probably damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Eftud2 C T 11: 102,840,108 R825H probably damaging Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Fdx1l A T 9: 21,073,327 probably null Het
Frem1 T C 4: 83,016,406 D106G possibly damaging Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Klhdc2 G A 12: 69,304,632 probably null Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Nlgn1 T C 3: 25,435,907 D552G probably damaging Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Pde11a C T 2: 76,291,203 V345I probably benign Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Pygl A G 12: 70,206,356 probably null Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTGGTTGTACTTAGGCAG -3'
(R):5'- GTTGATGCACATGAATGTCCC -3'

Sequencing Primer
(F):5'- GTACTTAGGCAGATGTCAGTAAATG -3'
(R):5'- CATGAATGTCCCCATTCAAATATA -3'
Posted On2019-12-27