Incidental Mutation 'R7971:Olfr364-ps1'
ID614306
Institutional Source Beutler Lab
Gene Symbol Olfr364-ps1
Ensembl Gene ENSMUSG00000078198
Gene Nameolfactory receptor 364, pseudogene 1
SynonymsGA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7971 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37139322-37148585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37146322 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 37 (M37L)
Ref Sequence ENSEMBL: ENSMUSP00000100611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104995] [ENSMUST00000214905] [ENSMUST00000217298]
Predicted Effect probably benign
Transcript: ENSMUST00000104995
AA Change: M37L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100611
Gene: ENSMUSG00000078198
AA Change: M37L

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 4.8e-58 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214905
AA Change: M37L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217298
AA Change: M37L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Atp4b A G 8: 13,389,811 F137S probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Olfr364-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr364-ps1 APN 2 37147067 missense probably damaging 1.00
IGL01550:Olfr364-ps1 APN 2 37146974 missense probably damaging 1.00
IGL01791:Olfr364-ps1 APN 2 37146536 missense probably damaging 1.00
IGL01886:Olfr364-ps1 APN 2 37146509 missense probably damaging 1.00
IGL02680:Olfr364-ps1 APN 2 37146415 missense probably damaging 1.00
IGL03003:Olfr364-ps1 APN 2 37146452 missense probably benign 0.00
IGL03289:Olfr364-ps1 APN 2 37146578 missense probably damaging 1.00
R0627:Olfr364-ps1 UTSW 2 37146330 missense probably damaging 0.96
R1163:Olfr364-ps1 UTSW 2 37147027 missense probably damaging 1.00
R1253:Olfr364-ps1 UTSW 2 37146872 missense possibly damaging 0.89
R1340:Olfr364-ps1 UTSW 2 37146757 missense probably benign 0.03
R1542:Olfr364-ps1 UTSW 2 37146966 missense probably damaging 1.00
R1633:Olfr364-ps1 UTSW 2 37146971 missense probably damaging 0.99
R2935:Olfr364-ps1 UTSW 2 37147111 missense possibly damaging 0.75
R2982:Olfr364-ps1 UTSW 2 37146381 missense probably damaging 0.99
R3855:Olfr364-ps1 UTSW 2 37146823 missense possibly damaging 0.95
R4849:Olfr364-ps1 UTSW 2 37146254 missense probably damaging 0.97
R4903:Olfr364-ps1 UTSW 2 37146371 missense probably benign 0.35
R5160:Olfr364-ps1 UTSW 2 37146803 missense probably benign 0.03
R7092:Olfr364-ps1 UTSW 2 37146611 missense probably damaging 1.00
R7108:Olfr364-ps1 UTSW 2 37146260 missense probably benign 0.00
R7143:Olfr364-ps1 UTSW 2 37146874 missense probably benign 0.00
R7278:Olfr364-ps1 UTSW 2 37147009 missense probably benign 0.29
R7630:Olfr364-ps1 UTSW 2 37146359 missense probably damaging 1.00
R7754:Olfr364-ps1 UTSW 2 37146846 missense possibly damaging 0.83
R7888:Olfr364-ps1 UTSW 2 37146322 missense probably benign
Z1088:Olfr364-ps1 UTSW 2 37146385 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATTGCAGGCCAGAGGATAG -3'
(R):5'- TCCGTGTTTGCTAATGCTATGAAG -3'

Sequencing Primer
(F):5'- GGATAGGAGAAACATTGTCTTGATC -3'
(R):5'- GAAGTACATCTGAACTAGGCATCC -3'
Posted On2019-12-27