Incidental Mutation 'R0671:N4bp2'
ID 61432
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene Name NEDD4 binding protein 2
Synonyms B3bp, LOC333789, LOC386488
MMRRC Submission 038856-MU
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R0671 (G1)
Quality Score 149
Status Validated
Chromosome 5
Chromosomal Location 65763521-65830108 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65807437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 943 (I943T)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
AlphaFold F8VQG7
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: I943T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: I943T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113738
AA Change: I943T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109367
Gene: ENSMUSG00000037795
AA Change: I943T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200843
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: I943T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: I943T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: I943T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: I943T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202411
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 (GRCm38) probably benign Het
4930430A15Rik A C 2: 111,204,137 (GRCm38) V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 (GRCm38) T31I probably benign Het
Abca17 A G 17: 24,281,249 (GRCm38) F1323L probably benign Het
Abcf3 T A 16: 20,550,487 (GRCm38) N206K probably damaging Het
Adam10 A G 9: 70,765,941 (GRCm38) probably benign Het
Adamtsl3 A T 7: 82,523,182 (GRCm38) Q451L probably damaging Het
Adgrl3 T A 5: 81,560,905 (GRCm38) I413N probably benign Het
Asb18 G T 1: 89,993,171 (GRCm38) A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 (GRCm38) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm38) C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 (GRCm38) E2235G probably damaging Het
Blnk G T 19: 40,937,667 (GRCm38) S330* probably null Het
Bpnt1 T G 1: 185,356,611 (GRCm38) N319K probably benign Het
Brip1 G A 11: 86,152,667 (GRCm38) T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 (GRCm38) D288E probably benign Het
Calcoco2 A G 11: 96,107,528 (GRCm38) V23A probably damaging Het
Cand2 G A 6: 115,803,805 (GRCm38) E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 (GRCm38) probably benign Het
Cdk12 T C 11: 98,230,109 (GRCm38) probably benign Het
Clec4a3 A G 6: 122,954,034 (GRCm38) probably null Het
Cpne2 T A 8: 94,548,342 (GRCm38) probably benign Het
Cyfip1 T C 7: 55,923,962 (GRCm38) probably null Het
Cyp26c1 A G 19: 37,686,561 (GRCm38) H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 (GRCm38) Y75H probably damaging Het
Defb43 T A 14: 63,011,838 (GRCm38) V10D probably damaging Het
Dhx36 G A 3: 62,493,741 (GRCm38) S368L possibly damaging Het
Dock6 G A 9: 21,804,627 (GRCm38) probably benign Het
Elp2 T C 18: 24,612,442 (GRCm38) probably benign Het
Emilin3 A G 2: 160,908,329 (GRCm38) L453P probably damaging Het
Eml6 A T 11: 29,805,065 (GRCm38) D903E probably benign Het
Ep300 T C 15: 81,616,134 (GRCm38) probably benign Het
Ep400 G A 5: 110,688,196 (GRCm38) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm38) S620P probably benign Het
Fbxo42 G A 4: 141,195,239 (GRCm38) V239M probably damaging Het
Fermt2 T C 14: 45,469,319 (GRCm38) D340G probably benign Het
Filip1 A T 9: 79,819,390 (GRCm38) V649E probably damaging Het
Fut8 G A 12: 77,475,017 (GRCm38) E477K probably damaging Het
Gbp3 G A 3: 142,565,390 (GRCm38) G185D probably benign Het
Gclc G T 9: 77,786,798 (GRCm38) D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 (GRCm38) D43G possibly damaging Het
Gm960 A G 19: 4,626,188 (GRCm38) S639P probably damaging Het
Gnptab A G 10: 88,443,304 (GRCm38) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm38) T206I probably damaging Het
Grk4 A G 5: 34,748,267 (GRCm38) N452S probably benign Het
Hcn2 G C 10: 79,734,232 (GRCm38) probably null Het
Hpn T C 7: 31,109,160 (GRCm38) K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 (GRCm38) D3268G probably damaging Het
Immt A T 6: 71,871,557 (GRCm38) Q467L possibly damaging Het
Kalrn T C 16: 34,116,408 (GRCm38) S1636G probably benign Het
Kcnh8 T A 17: 52,978,113 (GRCm38) L1037* probably null Het
Klhl33 T C 14: 50,892,394 (GRCm38) T548A probably damaging Het
Klri2 T C 6: 129,740,208 (GRCm38) I71V probably benign Het
Kmt2c A T 5: 25,404,365 (GRCm38) C254S probably damaging Het
Lama3 T C 18: 12,477,590 (GRCm38) I1170T possibly damaging Het
Med12l A G 3: 59,264,929 (GRCm38) Q1702R probably damaging Het
Mga A T 2: 119,919,910 (GRCm38) probably null Het
Mis18a A T 16: 90,720,673 (GRCm38) I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 (GRCm38) D83G probably benign Het
Mroh2a C A 1: 88,242,420 (GRCm38) A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 (GRCm38) probably benign Het
Mrrf C T 2: 36,153,698 (GRCm38) A149V probably benign Het
Mycbp2 A T 14: 103,194,588 (GRCm38) M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 (GRCm38) Q2387R probably benign Het
Ncapd3 T A 9: 27,087,477 (GRCm38) N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 (GRCm38) probably null Het
Ncor2 C T 5: 125,049,387 (GRCm38) A136T probably benign Het
Olfr311 T A 11: 58,841,855 (GRCm38) I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 (GRCm38) Y282* probably null Het
Olfr539 A G 7: 140,667,677 (GRCm38) D123G probably damaging Het
Olfr887 T A 9: 38,085,127 (GRCm38) M97K possibly damaging Het
Opa1 T C 16: 29,602,207 (GRCm38) probably benign Het
Pcdhb4 T C 18: 37,307,742 (GRCm38) M35T probably benign Het
Per3 T C 4: 151,028,831 (GRCm38) I347V probably benign Het
Pex13 G A 11: 23,665,831 (GRCm38) P5L possibly damaging Het
Phkb T A 8: 85,875,693 (GRCm38) W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 (GRCm38) D247E probably benign Het
Plxnb2 A G 15: 89,157,981 (GRCm38) S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 (GRCm38) H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 (GRCm38) N196H possibly damaging Het
Rab27a G T 9: 73,075,433 (GRCm38) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm38) C82* probably null Het
Rccd1 A T 7: 80,320,217 (GRCm38) probably benign Het
Riiad1 T C 3: 94,472,239 (GRCm38) I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 (GRCm38) E77G probably damaging Het
Rnf126 A T 10: 79,761,607 (GRCm38) I157N possibly damaging Het
Rnf207 T C 4: 152,307,468 (GRCm38) R623G probably benign Het
Rpusd1 T G 17: 25,728,524 (GRCm38) F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 (GRCm38) probably null Het
Scfd1 A T 12: 51,412,628 (GRCm38) Q324L probably benign Het
Skint3 G T 4: 112,255,777 (GRCm38) E195* probably null Het
Slc7a10 A T 7: 35,197,333 (GRCm38) T165S probably benign Het
Smagp A G 15: 100,621,852 (GRCm38) I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 (GRCm38) H172R probably damaging Het
Spast A G 17: 74,339,451 (GRCm38) probably benign Het
Sspo G T 6: 48,490,391 (GRCm38) probably benign Het
Ston2 C T 12: 91,740,466 (GRCm38) probably null Het
Tas2r103 T G 6: 133,036,350 (GRCm38) E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 (GRCm38) probably benign Het
Telo2 G A 17: 25,113,165 (GRCm38) P143L probably benign Het
Tgfbi A T 13: 56,638,726 (GRCm38) Y674F probably null Het
Tha1 T A 11: 117,873,157 (GRCm38) probably benign Het
Timp4 T A 6: 115,249,853 (GRCm38) S110C probably damaging Het
Tlr6 T C 5: 64,954,592 (GRCm38) K324R probably benign Het
Tnip3 A G 6: 65,597,363 (GRCm38) E137G probably damaging Het
Trak1 T C 9: 121,448,955 (GRCm38) probably null Het
Trim47 A G 11: 116,108,352 (GRCm38) S233P probably benign Het
Tspoap1 A T 11: 87,762,809 (GRCm38) E155V probably damaging Het
Tsta3 A G 15: 75,928,958 (GRCm38) V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 (GRCm38) L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 (GRCm38) S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 (GRCm38) V36D probably damaging Het
Wdr27 T C 17: 14,928,396 (GRCm38) T112A probably benign Het
Wdr90 T C 17: 25,846,393 (GRCm38) T1630A probably benign Het
Zfp352 A G 4: 90,223,919 (GRCm38) T99A probably benign Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65,807,524 (GRCm38) missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65,803,547 (GRCm38) nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65,790,924 (GRCm38) missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65,798,134 (GRCm38) missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65,803,552 (GRCm38) missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65,807,677 (GRCm38) missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65,790,960 (GRCm38) missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65,803,573 (GRCm38) splice site probably benign
R0285:N4bp2 UTSW 5 65,806,559 (GRCm38) missense probably benign 0.00
R0366:N4bp2 UTSW 5 65,806,396 (GRCm38) missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65,808,153 (GRCm38) missense probably benign 0.39
R0551:N4bp2 UTSW 5 65,820,341 (GRCm38) splice site probably null
R1136:N4bp2 UTSW 5 65,808,472 (GRCm38) missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65,790,498 (GRCm38) missense probably benign 0.01
R1597:N4bp2 UTSW 5 65,807,140 (GRCm38) missense probably benign 0.45
R1628:N4bp2 UTSW 5 65,803,572 (GRCm38) splice site probably null
R1722:N4bp2 UTSW 5 65,806,882 (GRCm38) missense probably benign 0.08
R1735:N4bp2 UTSW 5 65,808,316 (GRCm38) missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65,790,822 (GRCm38) missense probably benign 0.12
R1759:N4bp2 UTSW 5 65,826,613 (GRCm38) missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65,806,825 (GRCm38) missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65,808,519 (GRCm38) missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65,794,518 (GRCm38) splice site probably benign
R2042:N4bp2 UTSW 5 65,826,621 (GRCm38) missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65,807,565 (GRCm38) missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65,790,881 (GRCm38) missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65,809,200 (GRCm38) missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65,806,728 (GRCm38) missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65,790,061 (GRCm38) missense probably benign 0.01
R2508:N4bp2 UTSW 5 65,790,061 (GRCm38) missense probably benign 0.01
R2919:N4bp2 UTSW 5 65,807,098 (GRCm38) missense probably benign 0.22
R3086:N4bp2 UTSW 5 65,791,053 (GRCm38) missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65,790,456 (GRCm38) missense probably benign 0.02
R4177:N4bp2 UTSW 5 65,798,170 (GRCm38) splice site probably null
R4718:N4bp2 UTSW 5 65,803,463 (GRCm38) missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65,825,298 (GRCm38) missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65,808,130 (GRCm38) missense probably benign 0.22
R4915:N4bp2 UTSW 5 65,803,504 (GRCm38) missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65,821,799 (GRCm38) splice site probably null
R4978:N4bp2 UTSW 5 65,790,240 (GRCm38) missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65,814,780 (GRCm38) missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65,811,977 (GRCm38) missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65,817,218 (GRCm38) missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65,808,462 (GRCm38) missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65,807,518 (GRCm38) missense probably benign
R5322:N4bp2 UTSW 5 65,790,457 (GRCm38) missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65,808,114 (GRCm38) missense probably benign 0.44
R5731:N4bp2 UTSW 5 65,809,157 (GRCm38) missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65,808,094 (GRCm38) missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65,791,001 (GRCm38) missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65,817,187 (GRCm38) missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65,806,846 (GRCm38) missense probably benign 0.01
R7112:N4bp2 UTSW 5 65,790,707 (GRCm38) missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65,808,022 (GRCm38) missense probably benign 0.00
R7177:N4bp2 UTSW 5 65,807,548 (GRCm38) missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65,794,545 (GRCm38) missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65,806,371 (GRCm38) missense probably benign 0.01
R7450:N4bp2 UTSW 5 65,825,300 (GRCm38) nonsense probably null
R7560:N4bp2 UTSW 5 65,791,115 (GRCm38) missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65,808,157 (GRCm38) missense probably benign 0.00
R7743:N4bp2 UTSW 5 65,808,459 (GRCm38) missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65,807,103 (GRCm38) missense probably benign 0.00
R7981:N4bp2 UTSW 5 65,812,142 (GRCm38) missense probably benign 0.41
R8065:N4bp2 UTSW 5 65,807,296 (GRCm38) missense probably damaging 0.99
R8067:N4bp2 UTSW 5 65,807,296 (GRCm38) missense probably damaging 0.99
R8164:N4bp2 UTSW 5 65,809,223 (GRCm38) missense probably damaging 1.00
R8166:N4bp2 UTSW 5 65,820,312 (GRCm38) missense probably benign 0.39
R8331:N4bp2 UTSW 5 65,807,600 (GRCm38) missense probably damaging 1.00
R8559:N4bp2 UTSW 5 65,825,285 (GRCm38) missense possibly damaging 0.62
R8806:N4bp2 UTSW 5 65,808,208 (GRCm38) missense possibly damaging 0.63
R9287:N4bp2 UTSW 5 65,803,512 (GRCm38) missense probably benign 0.38
R9369:N4bp2 UTSW 5 65,806,916 (GRCm38) missense probably damaging 0.97
R9460:N4bp2 UTSW 5 65,806,543 (GRCm38) missense probably benign 0.00
R9462:N4bp2 UTSW 5 65,790,555 (GRCm38) missense probably benign 0.02
R9605:N4bp2 UTSW 5 65,806,536 (GRCm38) missense probably benign 0.02
R9641:N4bp2 UTSW 5 65,790,692 (GRCm38) missense probably benign 0.15
Z1177:N4bp2 UTSW 5 65,807,637 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGCCCAGTCAAACAGCTC -3'
(R):5'- CAGACTCATCAGCACTGGTAAGCTC -3'

Sequencing Primer
(F):5'- AGCTCCTGAGCATCATCCG -3'
(R):5'- AGCACTGGTAAGCTCACTTTC -3'
Posted On 2013-07-30