Incidental Mutation 'R7971:Atp4b'
ID614323
Institutional Source Beutler Lab
Gene Symbol Atp4b
Ensembl Gene ENSMUSG00000031449
Gene NameATPase, H+/K+ exchanging, beta polypeptide
SynonymsH+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7971 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13386205-13396825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13389811 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 137 (F137S)
Ref Sequence ENSEMBL: ENSMUSP00000033826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033826]
Predicted Effect probably damaging
Transcript: ENSMUST00000033826
AA Change: F137S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033826
Gene: ENSMUSG00000031449
AA Change: F137S

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 7 288 5.7e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal but have hypertrophied stomach mucosa, neutral luminal pH in the stomach, and hypergastrinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 G T 14: 8,246,415 Q459K probably benign Het
Ano3 T A 2: 110,666,428 Y792F probably damaging Het
Aoc3 C T 11: 101,332,497 H520Y probably damaging Het
Blvrb A G 7: 27,465,734 T160A probably damaging Het
Brd2 G A 17: 34,117,021 R73W probably damaging Het
Btaf1 A G 19: 36,965,636 T306A probably benign Het
Ccdc154 G A 17: 25,164,604 V212M possibly damaging Het
Ccdc40 A G 11: 119,229,141 E3G unknown Het
Cenpb T A 2: 131,179,842 E12V probably damaging Het
Cnot8 T C 11: 58,111,311 S57P probably benign Het
Cryba4 T C 5: 112,251,052 E42G probably benign Het
Fam129b T A 2: 32,922,125 Y406* probably null Het
Fam72a T A 1: 131,528,840 I47N probably damaging Het
Gm27027 A C 2: 93,957,535 probably null Het
Itgb2 T C 10: 77,564,644 V697A probably benign Het
Jakmip1 A G 5: 37,104,864 N336D probably damaging Het
Kansl1 T C 11: 104,342,422 T760A probably benign Het
Lrrc37a T A 11: 103,501,481 E1039D probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Mtss1 A T 15: 58,972,524 M82K probably damaging Het
Myo6 T C 9: 80,296,665 S1063P probably damaging Het
Nsun6 T A 2: 14,996,544 E400D probably benign Het
Olfr1057 C A 2: 86,374,926 C162F probably benign Het
Olfr121 A T 17: 37,751,997 N48Y probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr221 A G 14: 52,035,890 S74P probably damaging Het
Olfr364-ps1 A T 2: 37,146,322 M37L probably benign Het
Olfr385 T C 11: 73,589,528 D70G probably damaging Het
Olfr608 T A 7: 103,470,799 Y253* probably null Het
Pfdn5 T A 15: 102,328,589 V92E probably damaging Het
Pik3c2g T C 6: 139,896,744 V801A Het
Psme2b T A 11: 48,945,575 T182S possibly damaging Het
Ptcd3 G A 6: 71,883,447 A592V probably damaging Het
Rabgap1 T A 2: 37,537,307 Y633* probably null Het
Rnf39 A T 17: 36,947,241 T222S probably damaging Het
Scnn1g A G 7: 121,743,655 N277S probably damaging Het
Slc16a13 T G 11: 70,218,980 I232L possibly damaging Het
Slco2b1 T G 7: 99,688,843 R111S unknown Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tmc3 T C 7: 83,600,009 W269R probably damaging Het
Vmn2r4 T C 3: 64,406,522 E346G probably damaging Het
Vps52 A G 17: 33,965,751 N666S probably damaging Het
Wdfy4 C T 14: 33,090,963 D1618N Het
Zfp773 C A 7: 7,132,979 C206F probably benign Het
Other mutations in Atp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Atp4b APN 8 13389679 missense probably damaging 1.00
IGL02596:Atp4b APN 8 13393471 missense possibly damaging 0.87
R0558:Atp4b UTSW 8 13393523 missense possibly damaging 0.62
R0829:Atp4b UTSW 8 13390098 missense probably damaging 1.00
R0963:Atp4b UTSW 8 13390014 missense probably benign 0.00
R1528:Atp4b UTSW 8 13389693 missense possibly damaging 0.78
R1605:Atp4b UTSW 8 13393489 missense probably damaging 1.00
R2022:Atp4b UTSW 8 13387477 missense possibly damaging 0.88
R3824:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R3825:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R4108:Atp4b UTSW 8 13396640 critical splice donor site probably null
R4400:Atp4b UTSW 8 13388810 missense probably damaging 1.00
R4606:Atp4b UTSW 8 13389998 missense probably damaging 1.00
R4681:Atp4b UTSW 8 13389700 missense probably benign 0.01
R6056:Atp4b UTSW 8 13388782 missense probably damaging 1.00
R7485:Atp4b UTSW 8 13386732 missense probably benign
R7888:Atp4b UTSW 8 13389811 missense probably damaging 0.98
Z1177:Atp4b UTSW 8 13389794 missense probably benign 0.00
Z1177:Atp4b UTSW 8 13396684 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGCAGGACCCTTGTAAC -3'
(R):5'- TGAAAACAGTTCCTGGGCTG -3'

Sequencing Primer
(F):5'- GAGCAGGACCCTTGTAACTCACTC -3'
(R):5'- CTTCTTAGCAGGTGAGTGACC -3'
Posted On2019-12-27