Incidental Mutation 'R0671:Adgrl3'
ID61433
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Nameadhesion G protein-coupled receptor L3
SynonymsLEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik
MMRRC Submission 038856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0671 (G1)
Quality Score109
Status Validated
Chromosome5
Chromosomal Location81020138-81825133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81560905 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 413 (I413N)
Ref Sequence ENSEMBL: ENSMUSP00000112470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120673] [ENSMUST00000120445] [ENSMUST00000120292] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000120144] [ENSMUST00000121641] [ENSMUST00000132375]
Predicted Effect probably benign
Transcript: ENSMUST00000036068
AA Change: I481N

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072521
AA Change: I481N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117253
AA Change: I413N

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117407
AA Change: I481N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117985
AA Change: I413N

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118034
AA Change: I413N

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118078
AA Change: I413N

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118442
AA Change: I481N

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119385
AA Change: I481N

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119788
AA Change: I481N

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120128
AA Change: I413N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120673
AA Change: I481N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120445
AA Change: I481N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120292
AA Change: I413N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121707
AA Change: I481N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122037
AA Change: I413N

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122356
AA Change: I481N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120144
AA Change: I413N

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: I413N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121641
AA Change: I481N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: I481N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149280
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Meta Mutation Damage Score 0.1303 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 probably benign Het
4930430A15Rik A C 2: 111,204,137 V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 T31I probably benign Het
Abca17 A G 17: 24,281,249 F1323L probably benign Het
Abcf3 T A 16: 20,550,487 N206K probably damaging Het
Adam10 A G 9: 70,765,941 probably benign Het
Adamtsl3 A T 7: 82,523,182 Q451L probably damaging Het
Asb18 G T 1: 89,993,171 A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 E2235G probably damaging Het
Blnk G T 19: 40,937,667 S330* probably null Het
Bpnt1 T G 1: 185,356,611 N319K probably benign Het
Brip1 G A 11: 86,152,667 T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 D288E probably benign Het
Calcoco2 A G 11: 96,107,528 V23A probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 probably benign Het
Cdk12 T C 11: 98,230,109 probably benign Het
Clec4a3 A G 6: 122,954,034 probably null Het
Cpne2 T A 8: 94,548,342 probably benign Het
Cyfip1 T C 7: 55,923,962 probably null Het
Cyp26c1 A G 19: 37,686,561 H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Defb43 T A 14: 63,011,838 V10D probably damaging Het
Dhx36 G A 3: 62,493,741 S368L possibly damaging Het
Dock6 G A 9: 21,804,627 probably benign Het
Elp2 T C 18: 24,612,442 probably benign Het
Emilin3 A G 2: 160,908,329 L453P probably damaging Het
Eml6 A T 11: 29,805,065 D903E probably benign Het
Ep300 T C 15: 81,616,134 probably benign Het
Ep400 G A 5: 110,688,196 T1899M unknown Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fbxo42 G A 4: 141,195,239 V239M probably damaging Het
Fermt2 T C 14: 45,469,319 D340G probably benign Het
Filip1 A T 9: 79,819,390 V649E probably damaging Het
Fut8 G A 12: 77,475,017 E477K probably damaging Het
Gbp3 G A 3: 142,565,390 G185D probably benign Het
Gclc G T 9: 77,786,798 D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 D43G possibly damaging Het
Gm960 A G 19: 4,626,188 S639P probably damaging Het
Gnptab A G 10: 88,443,304 probably benign Het
Greb1l C T 18: 10,474,303 T206I probably damaging Het
Grk4 A G 5: 34,748,267 N452S probably benign Het
Hcn2 G C 10: 79,734,232 probably null Het
Hpn T C 7: 31,109,160 K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 D3268G probably damaging Het
Immt A T 6: 71,871,557 Q467L possibly damaging Het
Kalrn T C 16: 34,116,408 S1636G probably benign Het
Kcnh8 T A 17: 52,978,113 L1037* probably null Het
Klhl33 T C 14: 50,892,394 T548A probably damaging Het
Klri2 T C 6: 129,740,208 I71V probably benign Het
Kmt2c A T 5: 25,404,365 C254S probably damaging Het
Lama3 T C 18: 12,477,590 I1170T possibly damaging Het
Med12l A G 3: 59,264,929 Q1702R probably damaging Het
Mga A T 2: 119,919,910 probably null Het
Mis18a A T 16: 90,720,673 I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 D83G probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 probably benign Het
Mrrf C T 2: 36,153,698 A149V probably benign Het
Mycbp2 A T 14: 103,194,588 M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 Q2387R probably benign Het
N4bp2 T C 5: 65,807,437 I943T probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 probably null Het
Ncor2 C T 5: 125,049,387 A136T probably benign Het
Olfr311 T A 11: 58,841,855 I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 Y282* probably null Het
Olfr539 A G 7: 140,667,677 D123G probably damaging Het
Olfr887 T A 9: 38,085,127 M97K possibly damaging Het
Opa1 T C 16: 29,602,207 probably benign Het
Pcdhb4 T C 18: 37,307,742 M35T probably benign Het
Per3 T C 4: 151,028,831 I347V probably benign Het
Pex13 G A 11: 23,665,831 P5L possibly damaging Het
Phkb T A 8: 85,875,693 W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 D247E probably benign Het
Plxnb2 A G 15: 89,157,981 S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 N196H possibly damaging Het
Rab27a G T 9: 73,075,433 D7Y probably damaging Het
Rars2 T A 4: 34,630,505 C82* probably null Het
Rccd1 A T 7: 80,320,217 probably benign Het
Riiad1 T C 3: 94,472,239 I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 E77G probably damaging Het
Rnf126 A T 10: 79,761,607 I157N possibly damaging Het
Rnf207 T C 4: 152,307,468 R623G probably benign Het
Rpusd1 T G 17: 25,728,524 F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 probably null Het
Scfd1 A T 12: 51,412,628 Q324L probably benign Het
Skint3 G T 4: 112,255,777 E195* probably null Het
Slc7a10 A T 7: 35,197,333 T165S probably benign Het
Smagp A G 15: 100,621,852 I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 H172R probably damaging Het
Spast A G 17: 74,339,451 probably benign Het
Sspo G T 6: 48,490,391 probably benign Het
Ston2 C T 12: 91,740,466 probably null Het
Tas2r103 T G 6: 133,036,350 E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 probably benign Het
Telo2 G A 17: 25,113,165 P143L probably benign Het
Tgfbi A T 13: 56,638,726 Y674F probably null Het
Tha1 T A 11: 117,873,157 probably benign Het
Timp4 T A 6: 115,249,853 S110C probably damaging Het
Tlr6 T C 5: 64,954,592 K324R probably benign Het
Tnip3 A G 6: 65,597,363 E137G probably damaging Het
Trak1 T C 9: 121,448,955 probably null Het
Trim47 A G 11: 116,108,352 S233P probably benign Het
Tspoap1 A T 11: 87,762,809 E155V probably damaging Het
Tsta3 A G 15: 75,928,958 V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 V36D probably damaging Het
Wdr27 T C 17: 14,928,396 T112A probably benign Het
Wdr90 T C 17: 25,846,393 T1630A probably benign Het
Zfp352 A G 4: 90,223,919 T99A probably benign Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81724224 missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81646467 missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81794568 missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81693554 missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81693574 missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81560893 missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81726723 missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81688669 missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81465287 missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81694569 missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81387870 missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81465296 missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81512217 missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81512581 missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81512119 missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81792403 missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81771685 splice site probably benign
R0103:Adgrl3 UTSW 5 81792347 intron probably benign
R0138:Adgrl3 UTSW 5 81693607 missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0349:Adgrl3 UTSW 5 81771644 missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81726801 missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81693716 splice site probably benign
R0658:Adgrl3 UTSW 5 81648713 missense probably benign 0.18
R0679:Adgrl3 UTSW 5 81794977 missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81512353 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81387979 missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81794420 missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81771617 nonsense probably null
R1891:Adgrl3 UTSW 5 81512044 missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81688567 missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81512536 missense probably damaging 1.00
R2136:Adgrl3 UTSW 5 81512254 missense probably damaging 1.00
R2171:Adgrl3 UTSW 5 81512515 nonsense probably null
R2891:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81724256 missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81694526 missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81512544 missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81688510 missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81766205 missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81646578 missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81760724 missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81766234 missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81794271 missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81689646 missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81512110 missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81512048 missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81646551 missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81726669 missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81726801 missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81465341 intron probably benign
R5482:Adgrl3 UTSW 5 81794513 missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81724147 missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81693544 missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81646570 missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81512326 missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81646522 missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81688563 missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81688556 missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81726870 missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81794494 nonsense probably null
R6516:Adgrl3 UTSW 5 81465272 missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81787517 missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81794759 missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81741080 missense probably damaging 1.00
R6902:Adgrl3 UTSW 5 81689587 missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81648713 missense probably damaging 0.99
R7201:Adgrl3 UTSW 5 81724222 missense probably damaging 1.00
R7207:Adgrl3 UTSW 5 81310027 start codon destroyed probably null 0.33
R7215:Adgrl3 UTSW 5 81693550 missense probably damaging 1.00
R7376:Adgrl3 UTSW 5 81794750 missense probably damaging 1.00
R7441:Adgrl3 UTSW 5 81724140 missense possibly damaging 0.70
R7582:Adgrl3 UTSW 5 81693676 missense probably damaging 0.99
R7682:Adgrl3 UTSW 5 81794560 missense probably damaging 0.97
R7863:Adgrl3 UTSW 5 81512749 missense probably damaging 1.00
R7877:Adgrl3 UTSW 5 81694620 missense probably benign 0.30
R8051:Adgrl3 UTSW 5 81465266 missense probably damaging 1.00
R8237:Adgrl3 UTSW 5 81787561 frame shift probably null
R8390:Adgrl3 UTSW 5 81766210 missense probably damaging 1.00
R8392:Adgrl3 UTSW 5 81646550 missense probably benign 0.01
Z1088:Adgrl3 UTSW 5 81329882 missense probably benign 0.33
Z1088:Adgrl3 UTSW 5 81512158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGAATGCTGAAAGTTCACTTCTTCC -3'
(R):5'- TTTGAAAAGGTACTGCACTGCGAATGC -3'

Sequencing Primer
(F):5'- ggaaggaaggaaggaaggaaag -3'
(R):5'- CTGCACTGCGAATGCATATTAC -3'
Posted On2013-07-30