Incidental Mutation 'R7972:Fhod3'
ID614409
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24770494 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 95 (K95M)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably damaging
Transcript: ENSMUST00000037097
AA Change: K95M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: K95M

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 C T 4: 99,031,071 L23F probably benign Het
Art2a-ps C T 7: 101,555,211 S40N not run Het
Ash1l A G 3: 88,966,038 T43A probably benign Het
Atp1a2 G A 1: 172,278,064 probably null Het
Azi2 A G 9: 118,061,915 E336G probably benign Het
Cap2 A G 13: 46,646,575 H419R probably damaging Het
Ccdc14 T A 16: 34,723,836 S903T probably damaging Het
Cep72 A T 13: 74,050,122 S380T possibly damaging Het
Clca3a2 C A 3: 144,810,813 E341* probably null Het
Clcnkb T G 4: 141,410,604 I294L probably benign Het
Cyp2d9 T A 15: 82,455,826 M350K probably damaging Het
Dhx40 T G 11: 86,798,967 I266L probably benign Het
Dnah5 G T 15: 28,448,414 E4208* probably null Het
Ephb2 T C 4: 136,771,042 N242S probably damaging Het
Fam13b A T 18: 34,457,691 F478Y probably benign Het
Fastkd2 C G 1: 63,735,460 probably null Het
Fbxo40 T A 16: 36,969,650 D366V probably damaging Het
Foxo3 T A 10: 42,275,027 Q136L probably benign Het
Gadl1 A T 9: 115,954,815 Q236L possibly damaging Het
Galnt13 A G 2: 55,112,861 D560G probably benign Het
Ghsr A G 3: 27,372,166 S124G probably benign Het
Gkn2 A G 6: 87,378,286 probably null Het
Glyctk T A 9: 106,156,439 R68W unknown Het
Gm10031 G A 1: 156,525,395 A389T probably benign Het
Gm14025 T C 2: 129,036,994 E1004G unknown Het
Gm5157 G A 7: 21,184,716 P301S unknown Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hdc A T 2: 126,616,210 I64N probably damaging Het
Helq A T 5: 100,792,561 probably null Het
Ighv1-43 T C 12: 114,945,963 Y113C probably damaging Het
Ipo9 T C 1: 135,406,853 T273A probably benign Het
Itga4 G A 2: 79,316,045 V774I probably benign Het
Itpr3 T C 17: 27,116,777 L2287P probably damaging Het
Llgl1 T A 11: 60,707,312 I394N probably damaging Het
Mta1 G A 12: 113,131,688 R487H probably benign Het
Neb T C 2: 52,147,669 D7049G probably benign Het
Nlrp4f G A 13: 65,195,018 S271F probably damaging Het
Noxo1 A G 17: 24,699,382 D172G probably damaging Het
Nup155 T A 15: 8,121,507 V347E probably damaging Het
Oaf G T 9: 43,222,671 A251E possibly damaging Het
Pds5b T A 5: 150,792,172 F1039I probably damaging Het
Pla2g12b T A 10: 59,421,240 probably null Het
Prmt3 A G 7: 49,787,301 D208G possibly damaging Het
Ptcd3 G A 6: 71,888,608 T441M probably damaging Het
Rabl6 A G 2: 25,584,774 probably null Het
Shtn1 T A 19: 59,003,896 I417F probably damaging Het
Slc20a2 T C 8: 22,540,401 S158P probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Spata5 A G 3: 37,578,810 D855G probably benign Het
Spef2 T C 15: 9,717,563 Y232C probably damaging Het
Stard9 C T 2: 120,704,461 T3733I probably benign Het
Thrap3 A T 4: 126,178,062 F512L probably benign Het
Tmem150c A T 5: 100,093,104 I30K probably damaging Het
Tnnt1 C T 7: 4,508,583 A168T probably damaging Het
Trak2 A G 1: 58,918,824 L308P probably damaging Het
Trp53i11 T C 2: 93,198,899 L81P probably damaging Het
Usp16 T C 16: 87,474,584 Y344H probably benign Het
Wdr60 T A 12: 116,255,939 K128* probably null Het
Xrcc5 G T 1: 72,356,826 V593L probably benign Het
Zcchc14 A T 8: 121,604,895 H576Q unknown Het
Zfp616 T A 11: 74,085,445 C847S probably damaging Het
Zfp626 A T 7: 27,819,499 Y635F probably benign Het
Zfp799 G A 17: 32,819,499 R598* probably null Het
Zfp831 A G 2: 174,645,304 K591E possibly damaging Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
R7588:Fhod3 UTSW 18 25090248 missense probably benign 0.02
R7629:Fhod3 UTSW 18 24754317 missense probably benign 0.08
R7667:Fhod3 UTSW 18 25001944 missense probably benign
R7681:Fhod3 UTSW 18 24990038 missense probably damaging 1.00
R7829:Fhod3 UTSW 18 25115890 critical splice donor site probably null
R7889:Fhod3 UTSW 18 24770494 missense probably damaging 0.99
R8072:Fhod3 UTSW 18 25020665 small deletion probably benign
Z1177:Fhod3 UTSW 18 25020706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAAAGGCAAAGGTTTCC -3'
(R):5'- AACTGATGGCTACAAGCGGC -3'

Sequencing Primer
(F):5'- AGGCAAAGGTTTCCATTTTTGTTTCC -3'
(R):5'- TACAAGCGGCTCCCCTC -3'
Posted On2019-12-27