Incidental Mutation 'R7973:Zfp141'
ID614430
Institutional Source Beutler Lab
Gene Symbol Zfp141
Ensembl Gene ENSMUSG00000092416
Gene Namezinc finger protein 141
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7973 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42473386-42505740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42476479 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 190 (D190N)
Ref Sequence ENSEMBL: ENSMUSP00000133899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173489] [ENSMUST00000174407]
Predicted Effect probably benign
Transcript: ENSMUST00000173489
Predicted Effect probably damaging
Transcript: ENSMUST00000174407
AA Change: D190N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133899
Gene: ENSMUSG00000092416
AA Change: D190N

DomainStartEndE-ValueType
KRAB 18 78 4.41e-34 SMART
internal_repeat_1 146 405 8.73e-7 PROSPERO
ZnF_C2H2 410 432 4.54e-4 SMART
ZnF_C2H2 438 460 2.2e-2 SMART
ZnF_C2H2 466 488 2.95e-3 SMART
ZnF_C2H2 494 516 4.24e-4 SMART
ZnF_C2H2 522 544 9.58e-3 SMART
ZnF_C2H2 550 572 4.01e-5 SMART
ZnF_C2H2 578 600 3.21e-4 SMART
ZnF_C2H2 606 628 4.87e-4 SMART
ZnF_C2H2 634 656 5.99e-4 SMART
ZnF_C2H2 662 684 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in abnormal skin pigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,194 C77S Het
Aasdh T A 5: 76,884,122 K551N probably benign Het
Acp4 A C 7: 44,254,104 L262R probably damaging Het
Acsf3 G T 8: 122,785,965 probably null Het
Ago4 T C 4: 126,526,076 Q36R probably benign Het
Ankrd31 T A 13: 96,831,871 I672K probably benign Het
Astn1 A T 1: 158,580,333 D628V probably damaging Het
Brca2 T C 5: 150,539,381 V870A possibly damaging Het
Camk4 T C 18: 33,185,005 V405A probably benign Het
Carmil1 A T 13: 24,013,232 S146T Het
Cflar T A 1: 58,752,756 L406Q Het
Clic6 T A 16: 92,499,387 S312T probably benign Het
Col5a2 T C 1: 45,404,987 probably null Het
Ctc1 C A 11: 69,026,529 Q384K probably damaging Het
Defa24 A G 8: 21,734,540 K2E probably damaging Het
Dis3l C A 9: 64,322,471 A309S probably benign Het
Dnah9 A G 11: 66,072,072 S1806P probably damaging Het
Dolk C T 2: 30,284,714 V440I probably damaging Het
Erc2 A G 14: 28,040,341 probably null Het
Fntb T C 12: 76,873,450 probably null Het
Gm12569 C T 11: 51,234,838 S196L probably damaging Het
Gm21886 GCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT GCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT 18: 80,089,798 probably benign Het
Gm4846 A T 1: 166,494,659 V113E probably benign Het
Gm5592 G T 7: 41,286,759 Q228H probably damaging Het
Gm5916 T A 9: 36,120,995 T48S possibly damaging Het
Ift172 G T 5: 31,283,081 Y287* probably null Het
Il27ra T C 8: 84,033,985 I450M probably damaging Het
Krtap31-2 T A 11: 99,936,551 C70S possibly damaging Het
Lipo4 T A 19: 33,501,564 H292L probably damaging Het
Lyst T C 13: 13,740,569 F3283L probably damaging Het
Mctp1 T G 13: 76,827,757 C750G probably damaging Het
Mtmr7 T C 8: 40,551,735 D600G possibly damaging Het
Mylk C T 16: 34,963,648 Q1395* probably null Het
Nap1l5 T A 6: 58,906,888 D27V probably damaging Het
Nfkbib T C 7: 28,762,087 D75G probably damaging Het
Nlrc4 T A 17: 74,437,508 M793L probably benign Het
Olfr472 T C 7: 107,903,043 S109P probably benign Het
Olfr599 G T 7: 103,338,330 C92F probably benign Het
Olfr832 T C 9: 18,945,503 M285T probably benign Het
Olfr970 C T 9: 39,820,014 A125V probably damaging Het
Pcdh15 G A 10: 74,642,314 R207Q probably damaging Het
Plek T C 11: 16,995,238 T54A probably benign Het
Pno1 C A 11: 17,211,443 R22L probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Rapgef6 C G 11: 54,626,723 H414D probably damaging Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rpap2 T C 5: 107,606,911 C136R probably damaging Het
Rtl1 C T 12: 109,592,817 E863K possibly damaging Het
Ryr3 A T 2: 112,926,912 I366N probably damaging Het
Scn9a T C 2: 66,543,112 I508V probably benign Het
Sec14l3 A G 11: 4,074,795 D248G probably damaging Het
Six6 A T 12: 72,940,543 Q163L probably benign Het
Slco6c1 A G 1: 97,062,467 V683A possibly damaging Het
Smc1b A G 15: 85,066,328 V1165A probably damaging Het
Smgc A T 15: 91,847,076 Q241L possibly damaging Het
Tdrp A T 8: 13,955,727 S65T probably damaging Het
Tg A T 15: 66,683,814 Y785F probably damaging Het
Themis2 T G 4: 132,789,643 Q182P probably damaging Het
Tmem86b G T 7: 4,628,405 S216* probably null Het
Ttyh2 T A 11: 114,686,446 I61N possibly damaging Het
Vmn2r97 A T 17: 18,929,540 T397S probably benign Het
Zfp58 T C 13: 67,491,995 R126G possibly damaging Het
Other mutations in Zfp141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp141 APN 7 42475307 nonsense probably null
IGL00595:Zfp141 APN 7 42476655 missense probably benign 0.08
R0577:Zfp141 UTSW 7 42476514 missense probably benign 0.14
R0883:Zfp141 UTSW 7 42476056 missense possibly damaging 0.85
R1701:Zfp141 UTSW 7 42476046 missense probably benign 0.35
R2290:Zfp141 UTSW 7 42475225 missense probably damaging 1.00
R4176:Zfp141 UTSW 7 42476281 missense probably benign 0.04
R4719:Zfp141 UTSW 7 42476687 splice site probably null
R4897:Zfp141 UTSW 7 42476205 missense probably benign 0.24
R5372:Zfp141 UTSW 7 42477196 missense possibly damaging 0.91
R5438:Zfp141 UTSW 7 42489470 missense probably damaging 1.00
R5447:Zfp141 UTSW 7 42475559 nonsense probably null
R5743:Zfp141 UTSW 7 42476431 missense possibly damaging 0.68
R5969:Zfp141 UTSW 7 42489488 missense probably damaging 0.98
R6731:Zfp141 UTSW 7 42489500 missense probably damaging 0.99
R7127:Zfp141 UTSW 7 42475429 missense probably damaging 1.00
R7474:Zfp141 UTSW 7 42476254 nonsense probably null
R7572:Zfp141 UTSW 7 42475432 missense probably benign 0.03
R7830:Zfp141 UTSW 7 42475188 missense probably benign 0.01
R7890:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTACAATTTGAGCACTCATTTGC -3'
(R):5'- AATGACATGGACTGCAATGTAGATC -3'

Sequencing Primer
(F):5'- GCAATTTTATACTGCTGGCTGC -3'
(R):5'- TGGACTGCAATGTAGATCAACATAAG -3'
Posted On2019-12-27