Incidental Mutation 'R0671:Ncapd3'
ID 61451
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Name non-SMC condensin II complex, subunit D3
Synonyms 4632407J06Rik, 2810487N22Rik, B130055D15Rik
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0671 (G1)
Quality Score 163
Status Validated
Chromosome 9
Chromosomal Location 26941471-27006611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26998773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1254 (N1254K)
Ref Sequence ENSEMBL: ENSMUSP00000150938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073127
AA Change: N1254K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: N1254K

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086198
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214432
Predicted Effect probably benign
Transcript: ENSMUST00000216677
AA Change: N1254K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 26,963,649 (GRCm39) missense probably benign
IGL00544:Ncapd3 APN 9 26,974,634 (GRCm39) missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 26,983,120 (GRCm39) missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 26,983,261 (GRCm39) critical splice donor site probably null
IGL02073:Ncapd3 APN 9 26,974,612 (GRCm39) missense probably benign 0.03
IGL02083:Ncapd3 APN 9 26,963,117 (GRCm39) missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 26,961,624 (GRCm39) missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27,000,598 (GRCm39) missense probably benign 0.08
IGL02437:Ncapd3 APN 9 26,975,264 (GRCm39) splice site probably benign
IGL02861:Ncapd3 APN 9 26,981,195 (GRCm39) missense probably benign 0.00
IGL03202:Ncapd3 APN 9 26,983,011 (GRCm39) splice site probably benign
IGL03219:Ncapd3 APN 9 26,975,169 (GRCm39) splice site probably benign
IGL03252:Ncapd3 APN 9 26,962,745 (GRCm39) missense probably damaging 1.00
pevensie UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 26,963,105 (GRCm39) missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 26,967,407 (GRCm39) missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 26,969,179 (GRCm39) missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 26,975,401 (GRCm39) splice site probably benign
R0565:Ncapd3 UTSW 9 26,999,294 (GRCm39) missense probably benign 0.00
R0601:Ncapd3 UTSW 9 26,952,803 (GRCm39) missense probably benign 0.05
R0673:Ncapd3 UTSW 9 26,998,773 (GRCm39) missense probably benign 0.00
R0842:Ncapd3 UTSW 9 26,948,380 (GRCm39) missense probably benign 0.01
R1178:Ncapd3 UTSW 9 26,952,717 (GRCm39) missense probably benign
R1366:Ncapd3 UTSW 9 26,969,236 (GRCm39) missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 26,981,168 (GRCm39) splice site probably benign
R1439:Ncapd3 UTSW 9 26,998,862 (GRCm39) critical splice donor site probably null
R1532:Ncapd3 UTSW 9 26,994,656 (GRCm39) nonsense probably null
R2131:Ncapd3 UTSW 9 26,994,642 (GRCm39) missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 26,999,845 (GRCm39) missense probably benign 0.01
R2238:Ncapd3 UTSW 9 26,978,320 (GRCm39) missense probably benign
R2258:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2259:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2260:Ncapd3 UTSW 9 26,967,368 (GRCm39) missense probably benign 0.16
R2297:Ncapd3 UTSW 9 26,952,797 (GRCm39) nonsense probably null
R2877:Ncapd3 UTSW 9 26,955,783 (GRCm39) splice site probably null
R3612:Ncapd3 UTSW 9 26,961,653 (GRCm39) missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 26,963,645 (GRCm39) missense probably benign 0.00
R3791:Ncapd3 UTSW 9 26,963,931 (GRCm39) missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27,000,679 (GRCm39) splice site probably null
R4297:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4299:Ncapd3 UTSW 9 26,963,623 (GRCm39) missense probably benign
R4441:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27,005,911 (GRCm39) missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R4790:Ncapd3 UTSW 9 26,963,146 (GRCm39) missense probably benign 0.00
R4835:Ncapd3 UTSW 9 26,997,342 (GRCm39) missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 26,963,071 (GRCm39) missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 26,983,031 (GRCm39) nonsense probably null
R4939:Ncapd3 UTSW 9 26,975,165 (GRCm39) critical splice donor site probably null
R4980:Ncapd3 UTSW 9 26,974,591 (GRCm39) missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 26,983,062 (GRCm39) missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 26,963,015 (GRCm39) missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R5656:Ncapd3 UTSW 9 26,962,941 (GRCm39) missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27,006,054 (GRCm39) missense probably benign 0.00
R5900:Ncapd3 UTSW 9 26,978,265 (GRCm39) missense probably benign 0.26
R6093:Ncapd3 UTSW 9 26,967,454 (GRCm39) missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 26,975,278 (GRCm39) missense probably benign 0.00
R6249:Ncapd3 UTSW 9 26,999,349 (GRCm39) small deletion probably benign
R6428:Ncapd3 UTSW 9 26,963,960 (GRCm39) splice site probably null
R6432:Ncapd3 UTSW 9 26,955,805 (GRCm39) missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 26,974,712 (GRCm39) missense probably benign 0.03
R6459:Ncapd3 UTSW 9 26,963,051 (GRCm39) missense probably benign 0.00
R6567:Ncapd3 UTSW 9 26,978,300 (GRCm39) missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 26,998,852 (GRCm39) missense probably benign
R6862:Ncapd3 UTSW 9 26,942,105 (GRCm39) missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 26,961,655 (GRCm39) missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 26,981,254 (GRCm39) missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 26,978,315 (GRCm39) missense probably benign 0.01
R7541:Ncapd3 UTSW 9 26,978,336 (GRCm39) missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 26,983,144 (GRCm39) missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 26,966,801 (GRCm39) missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 26,974,736 (GRCm39) nonsense probably null
R7876:Ncapd3 UTSW 9 26,956,519 (GRCm39) critical splice donor site probably null
R7913:Ncapd3 UTSW 9 26,959,522 (GRCm39) nonsense probably null
R8068:Ncapd3 UTSW 9 26,974,657 (GRCm39) missense possibly damaging 0.66
R8147:Ncapd3 UTSW 9 26,942,014 (GRCm39) start gained probably benign
R8197:Ncapd3 UTSW 9 26,997,329 (GRCm39) missense probably damaging 0.98
R8264:Ncapd3 UTSW 9 27,006,038 (GRCm39) unclassified probably benign
R8353:Ncapd3 UTSW 9 26,983,100 (GRCm39) missense probably benign 0.03
R8539:Ncapd3 UTSW 9 26,959,520 (GRCm39) missense probably benign
R8839:Ncapd3 UTSW 9 27,005,730 (GRCm39) missense
R8917:Ncapd3 UTSW 9 26,999,297 (GRCm39) missense probably benign
R8997:Ncapd3 UTSW 9 26,959,577 (GRCm39) missense probably damaging 1.00
R9215:Ncapd3 UTSW 9 26,975,386 (GRCm39) missense possibly damaging 0.51
R9393:Ncapd3 UTSW 9 26,962,682 (GRCm39) missense possibly damaging 0.54
R9412:Ncapd3 UTSW 9 26,967,451 (GRCm39) nonsense probably null
R9688:Ncapd3 UTSW 9 26,967,349 (GRCm39) missense probably benign 0.01
R9746:Ncapd3 UTSW 9 26,974,655 (GRCm39) missense probably benign
R9749:Ncapd3 UTSW 9 26,956,873 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TAGACCGGAAACTTCCCGAGAGAC -3'
(R):5'- TTTCCAGGCAAAGTTCCCTCACAG -3'

Sequencing Primer
(F):5'- gccagggctacacaaagaaac -3'
(R):5'- GGGCCTTGGCAAAGAGAAG -3'
Posted On 2013-07-30