Incidental Mutation 'R7974:Psmb1'
ID614526
Institutional Source Beutler Lab
Gene Symbol Psmb1
Ensembl Gene ENSMUSG00000014769
Gene Nameproteasome (prosome, macropain) subunit, beta type 1
SynonymsLmpc5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R7974 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location15475021-15499751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15494486 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 50 (V50I)
Ref Sequence ENSEMBL: ENSMUSP00000014913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014913] [ENSMUST00000231341] [ENSMUST00000232500]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000014913
AA Change: V50I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000014913
Gene: ENSMUSG00000014769
AA Change: V50I

DomainStartEndE-ValueType
Pfam:Proteasome 33 225 8.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231341
AA Change: V50I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000232500
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T G 2: 165,078,944 E56D unknown Het
9930111J21Rik2 T C 11: 49,019,716 Q630R probably benign Het
Abca9 A G 11: 110,163,272 V68A probably benign Het
Acnat1 G A 4: 49,449,181 A195V possibly damaging Het
Acsl3 C T 1: 78,703,588 A612V probably benign Het
Adam12 A T 7: 133,998,232 D115E probably benign Het
Adam3 T A 8: 24,707,497 probably null Het
Aif1 G A 17: 35,172,624 probably benign Het
Ank3 A G 10: 69,988,309 D154G probably damaging Het
Arid3b A G 9: 57,810,159 C233R probably benign Het
Ccdc7b T A 8: 129,072,665 D74E unknown Het
Cckbr T A 7: 105,435,350 D430E probably benign Het
Chpf T C 1: 75,475,295 H667R probably benign Het
Dhx29 T G 13: 112,940,752 probably null Het
Dnah8 A G 17: 30,712,289 E1426G probably benign Het
Dync1h1 A G 12: 110,643,156 I2791V probably benign Het
Ehd3 A G 17: 73,816,392 N130S probably benign Het
Fam198b G A 3: 79,886,284 A20T probably benign Het
Fgfr4 A G 13: 55,159,151 T218A probably benign Het
Foxe1 G A 4: 46,344,599 E136K possibly damaging Het
Frmpd1 A G 4: 45,284,478 S1100G probably benign Het
Gm21886 T G 18: 80,089,757 Q62P probably null Het
Golga4 A G 9: 118,556,366 E852G probably damaging Het
Gprin3 T C 6: 59,353,711 D537G probably benign Het
Gpx5 C A 13: 21,288,748 D139Y probably damaging Het
Hmcn1 T C 1: 150,593,189 Y5007C probably damaging Het
Igsf10 G A 3: 59,328,411 R1450* probably null Het
Kif21a G A 15: 90,956,314 P1200S probably damaging Het
Kmt2c G A 5: 25,300,111 R3400C probably damaging Het
Miox A C 15: 89,336,539 M216L probably benign Het
Mphosph9 T C 5: 124,290,904 Y687C probably damaging Het
Nbeal1 T C 1: 60,260,432 L1309P probably benign Het
Olfr1116 A T 2: 87,269,077 T99S possibly damaging Het
Olfr1186 G A 2: 88,525,945 V121I probably benign Het
Olfr272 C T 4: 52,911,663 V44I probably benign Het
Olfr837 T C 9: 19,137,845 M284T possibly damaging Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Polq A G 16: 37,027,882 T284A probably damaging Het
Polrmt A T 10: 79,741,880 M295K probably damaging Het
Pou2af1 G T 9: 51,232,997 M70I probably damaging Het
Pou3f1 G A 4: 124,658,439 E245K probably damaging Het
Ptgis T C 2: 167,227,514 D50G probably damaging Het
R3hdm2 A G 10: 127,498,574 I955M probably benign Het
Rasef G A 4: 73,759,698 T97I probably benign Het
Rasef T C 4: 73,790,964 T11A probably benign Het
Sema4c C A 1: 36,549,914 L710F probably damaging Het
Slc39a10 C T 1: 46,812,168 A721T probably damaging Het
Spata31d1a A G 13: 59,700,325 C1330R possibly damaging Het
Susd1 T C 4: 59,349,915 D560G possibly damaging Het
Tnfrsf1b T C 4: 145,229,090 Y32C probably damaging Het
Trhr2 C A 8: 122,357,344 V306F probably damaging Het
Trpm6 A T 19: 18,776,710 Q35L probably benign Het
Ttbk2 A G 2: 120,786,029 S197P probably damaging Het
Uggt2 T A 14: 119,042,647 E806D probably benign Het
Ushbp1 T G 8: 71,388,778 Q469P possibly damaging Het
Vmn1r73 G A 7: 11,757,109 V285I possibly damaging Het
Zfp934 A C 13: 62,520,189 S63R probably benign Het
Other mutations in Psmb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Psmb1 APN 17 15490284 start codon destroyed probably null 0.21
R0416:Psmb1 UTSW 17 15494519 missense probably benign 0.00
R3908:Psmb1 UTSW 17 15490281 missense probably damaging 1.00
R4946:Psmb1 UTSW 17 15498216 missense probably benign 0.01
R4976:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R4979:Psmb1 UTSW 17 15476189 missense probably benign 0.23
R5119:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R5506:Psmb1 UTSW 17 15490216 missense probably damaging 1.00
R5939:Psmb1 UTSW 17 15498178 missense probably damaging 1.00
R6848:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7178:Psmb1 UTSW 17 15477259 missense possibly damaging 0.50
R7701:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7891:Psmb1 UTSW 17 15494486 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATAATCTTCCCAGCTGCCACC -3'
(R):5'- CAGGAATCCGTTTCTCCAGTC -3'

Sequencing Primer
(F):5'- TATTCTTCCAAAGGACCCAGGTGG -3'
(R):5'- AGGAATCCGTTTCTCCAGTCTTTTG -3'
Posted On2019-12-27