Incidental Mutation 'R0671:Gnptab'
ID 61461
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene Name N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms EG432486
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R0671 (G1)
Quality Score 124
Status Validated
Chromosome 10
Chromosomal Location 88214996-88283186 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 88279166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
AlphaFold Q69ZN6
Predicted Effect probably benign
Transcript: ENSMUST00000020251
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149562
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88,268,927 (GRCm39) missense probably damaging 0.99
IGL01346:Gnptab APN 10 88,272,041 (GRCm39) missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88,273,357 (GRCm39) missense probably damaging 0.98
IGL01642:Gnptab APN 10 88,271,994 (GRCm39) missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88,265,323 (GRCm39) missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88,276,151 (GRCm39) missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88,272,233 (GRCm39) missense possibly damaging 0.95
maze UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R0103:Gnptab UTSW 10 88,265,381 (GRCm39) missense probably damaging 1.00
R0103:Gnptab UTSW 10 88,265,381 (GRCm39) missense probably damaging 1.00
R0114:Gnptab UTSW 10 88,269,262 (GRCm39) missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88,275,372 (GRCm39) missense probably damaging 0.98
R0288:Gnptab UTSW 10 88,268,967 (GRCm39) missense probably benign 0.00
R0329:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0330:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0369:Gnptab UTSW 10 88,269,456 (GRCm39) missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88,272,387 (GRCm39) missense probably damaging 1.00
R0522:Gnptab UTSW 10 88,267,328 (GRCm39) splice site probably benign
R0569:Gnptab UTSW 10 88,264,419 (GRCm39) missense possibly damaging 0.89
R0834:Gnptab UTSW 10 88,265,814 (GRCm39) missense probably damaging 1.00
R1375:Gnptab UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R1443:Gnptab UTSW 10 88,269,943 (GRCm39) missense probably damaging 1.00
R1464:Gnptab UTSW 10 88,281,616 (GRCm39) splice site probably benign
R1471:Gnptab UTSW 10 88,281,625 (GRCm39) missense probably benign
R1570:Gnptab UTSW 10 88,255,316 (GRCm39) missense probably damaging 0.99
R1612:Gnptab UTSW 10 88,264,344 (GRCm39) splice site probably null
R1614:Gnptab UTSW 10 88,250,451 (GRCm39) missense probably benign
R1638:Gnptab UTSW 10 88,272,029 (GRCm39) missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88,271,957 (GRCm39) missense probably benign 0.14
R1894:Gnptab UTSW 10 88,254,989 (GRCm39) missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88,276,167 (GRCm39) nonsense probably null
R2118:Gnptab UTSW 10 88,272,260 (GRCm39) missense probably benign 0.13
R2144:Gnptab UTSW 10 88,264,368 (GRCm39) missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88,269,906 (GRCm39) missense probably damaging 1.00
R3847:Gnptab UTSW 10 88,269,439 (GRCm39) nonsense probably null
R3943:Gnptab UTSW 10 88,269,756 (GRCm39) missense probably benign
R4434:Gnptab UTSW 10 88,248,484 (GRCm39) missense probably damaging 1.00
R4545:Gnptab UTSW 10 88,250,457 (GRCm39) missense probably benign 0.00
R4776:Gnptab UTSW 10 88,272,390 (GRCm39) missense probably damaging 1.00
R4786:Gnptab UTSW 10 88,272,044 (GRCm39) missense probably damaging 1.00
R4880:Gnptab UTSW 10 88,268,413 (GRCm39) nonsense probably null
R4889:Gnptab UTSW 10 88,269,775 (GRCm39) missense probably benign 0.00
R4923:Gnptab UTSW 10 88,265,485 (GRCm39) missense probably benign 0.17
R5694:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R5943:Gnptab UTSW 10 88,269,376 (GRCm39) missense probably benign 0.00
R6027:Gnptab UTSW 10 88,269,087 (GRCm39) missense probably damaging 0.98
R6074:Gnptab UTSW 10 88,268,940 (GRCm39) missense probably damaging 1.00
R6119:Gnptab UTSW 10 88,267,257 (GRCm39) missense probably damaging 1.00
R6182:Gnptab UTSW 10 88,265,342 (GRCm39) missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88,273,364 (GRCm39) missense probably damaging 0.98
R6910:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R6911:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R7094:Gnptab UTSW 10 88,215,366 (GRCm39) missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88,276,174 (GRCm39) missense probably benign 0.19
R7164:Gnptab UTSW 10 88,269,932 (GRCm39) nonsense probably null
R7214:Gnptab UTSW 10 88,215,019 (GRCm39) unclassified probably benign
R7316:Gnptab UTSW 10 88,236,572 (GRCm39) missense probably damaging 1.00
R7463:Gnptab UTSW 10 88,267,251 (GRCm39) missense probably damaging 1.00
R7596:Gnptab UTSW 10 88,279,232 (GRCm39) missense probably damaging 0.99
R7654:Gnptab UTSW 10 88,281,681 (GRCm39) missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88,215,390 (GRCm39) missense probably damaging 0.99
R7770:Gnptab UTSW 10 88,247,782 (GRCm39) missense probably benign 0.41
R7791:Gnptab UTSW 10 88,276,084 (GRCm39) critical splice acceptor site probably null
R7838:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8002:Gnptab UTSW 10 88,276,130 (GRCm39) missense probably benign 0.14
R8168:Gnptab UTSW 10 88,254,995 (GRCm39) missense probably benign 0.41
R8219:Gnptab UTSW 10 88,269,654 (GRCm39) missense probably benign
R8221:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8313:Gnptab UTSW 10 88,275,071 (GRCm39) missense probably damaging 1.00
R8351:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R8487:Gnptab UTSW 10 88,268,508 (GRCm39) critical splice donor site probably null
R9108:Gnptab UTSW 10 88,269,400 (GRCm39) missense
R9352:Gnptab UTSW 10 88,268,350 (GRCm39) missense probably benign 0.05
R9489:Gnptab UTSW 10 88,268,992 (GRCm39) missense probably damaging 1.00
R9598:Gnptab UTSW 10 88,247,876 (GRCm39) missense probably damaging 0.97
R9760:Gnptab UTSW 10 88,267,310 (GRCm39) missense probably damaging 1.00
R9771:Gnptab UTSW 10 88,268,485 (GRCm39) missense probably damaging 1.00
X0064:Gnptab UTSW 10 88,272,392 (GRCm39) missense probably damaging 1.00
X0066:Gnptab UTSW 10 88,247,873 (GRCm39) missense probably damaging 0.99
Z1176:Gnptab UTSW 10 88,267,230 (GRCm39) missense probably damaging 1.00
Z1177:Gnptab UTSW 10 88,276,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGTAGATGCTGGTGCTGTAGG -3'
(R):5'- GTTGCCCAGGCTATACTCAAACCTC -3'

Sequencing Primer
(F):5'- ccccaataacaacacagacag -3'
(R):5'- TCCCAAGAACTGGGATTCTCC -3'
Posted On 2013-07-30