Incidental Mutation 'R7977:Cdon'
ID614696
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 35476948 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 740 (R740G)
Ref Sequence ENSEMBL: ENSMUSP00000045547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: R740G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: R740G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: R740G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: R740G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,106,589 M1551T possibly damaging Het
Abcc9 A G 6: 142,594,007 *1547Q probably null Het
Adamts20 A C 15: 94,351,760 C459G probably damaging Het
Adamts5 C T 16: 85,877,920 W452* probably null Het
Adcy8 G T 15: 64,920,205 Q301K possibly damaging Het
Adgrv1 A C 13: 81,567,451 C873G probably benign Het
AI314180 T C 4: 58,853,708 N361S probably damaging Het
Ak9 A G 10: 41,420,539 D1427G unknown Het
Amy2a1 T A 3: 113,530,541 M117L possibly damaging Het
Ap5z1 G T 5: 142,466,284 R23L probably benign Het
Ap5z1 C T 5: 142,470,436 Q337* probably null Het
Astn1 C A 1: 158,601,938 Q759K probably damaging Het
Cd276 T A 9: 58,537,479 T70S possibly damaging Het
Cd38 C T 5: 43,900,404 T106I probably damaging Het
Clk2 C T 3: 89,168,894 R124W possibly damaging Het
Cyp1b1 C T 17: 79,714,215 V33M possibly damaging Het
Dab1 T A 4: 104,732,138 D547E probably benign Het
Degs1 A T 1: 182,276,851 Y290N probably damaging Het
Degs1 G C 1: 182,276,852 H289Q probably benign Het
Dopey2 T A 16: 93,810,204 C2249S probably benign Het
Ehd4 A C 2: 120,102,428 Y172* probably null Het
Erc2 A G 14: 27,777,208 D347G probably damaging Het
Espl1 T G 15: 102,304,025 V522G probably damaging Het
Fabp9 T A 3: 10,197,167 T10S probably benign Het
Fam193a T C 5: 34,440,533 I558T possibly damaging Het
Fhod1 T C 8: 105,331,157 E912G probably damaging Het
Gja1 T C 10: 56,388,549 F335L possibly damaging Het
Gm14025 A C 2: 129,037,129 V959G unknown Het
Gm29106 A G 1: 118,199,535 H319R probably damaging Het
Hunk C T 16: 90,472,465 S299F probably damaging Het
Hydin C T 8: 110,513,010 T1974M possibly damaging Het
Ighv10-1 T A 12: 114,479,030 T112S probably damaging Het
Ireb2 T A 9: 54,882,336 V98E probably damaging Het
Irf4 A C 13: 30,753,452 H167P probably benign Het
Irf6 C T 1: 193,162,713 P164L probably benign Het
Josd1 A G 15: 79,677,250 I119T probably damaging Het
Kcna5 G T 6: 126,535,048 T39K probably damaging Het
Klhl24 A G 16: 20,123,000 D566G probably damaging Het
Kmt2a T A 9: 44,849,857 K232* probably null Het
Krt36 A G 11: 100,105,235 L121P probably damaging Het
Lama3 A T 18: 12,462,807 H931L probably benign Het
Lamp3 A T 16: 19,655,391 I411N probably damaging Het
Lingo3 C T 10: 80,834,776 W440* probably null Het
Mia2 T C 12: 59,189,647 Y712H probably damaging Het
Mlh1 T A 9: 111,230,077 probably null Het
Mta3 T A 17: 83,762,934 S174T probably benign Het
Myo15 A G 11: 60,491,137 T347A Het
Naaladl2 C T 3: 23,846,554 R704H possibly damaging Het
Nfib T C 4: 82,327,793 N394S probably benign Het
Nr2f2 A G 7: 70,359,933 Y133H probably damaging Het
Olfr1220 A G 2: 89,097,588 V113A possibly damaging Het
Olfr1314 A T 2: 112,092,477 C75S probably benign Het
Olfr320 C T 11: 58,684,674 S267F possibly damaging Het
Olfr486 T A 7: 108,172,184 M187L probably benign Het
Olfr94 C T 17: 37,197,156 E196K probably damaging Het
Phgdh C A 3: 98,339,808 V9L probably damaging Het
Pkd2 T A 5: 104,480,237 D392E probably damaging Het
Plekhm3 A G 1: 64,921,715 S461P probably benign Het
Prss39 A G 1: 34,500,227 T183A probably benign Het
Pter T A 2: 12,994,755 I235K probably damaging Het
Ptp4a3 T C 15: 73,756,907 V172A probably benign Het
Rasa2 T C 9: 96,602,727 N145D probably benign Het
Rasal2 A T 1: 157,243,648 H45Q probably benign Het
Rbm43 A G 2: 51,925,897 V104A probably damaging Het
Rhbdd2 C A 5: 135,639,115 probably null Het
Rimbp2 T A 5: 128,761,464 N1023I probably damaging Het
Rtl1 A T 12: 109,594,597 D269E possibly damaging Het
Sbp A G 17: 23,942,189 probably benign Het
Sema4d C A 13: 51,710,006 K412N probably benign Het
Sorbs1 T A 19: 40,327,576 T374S probably benign Het
Tgs1 A T 4: 3,598,652 K655I probably benign Het
Thsd1 A C 8: 22,259,569 T819P probably damaging Het
Tmprss11c C T 5: 86,231,796 V418M probably damaging Het
Top2a A T 11: 99,009,605 D645E probably damaging Het
Top2b G A 14: 16,413,081 V997I possibly damaging Het
Ttc34 A G 4: 154,859,383 D118G probably damaging Het
Ttll5 A G 12: 85,889,174 D353G probably damaging Het
Uba6 A T 5: 86,118,065 Y994* probably null Het
Vmn1r189 A T 13: 22,101,736 Y310* probably null Het
Vps13c T A 9: 67,926,983 I1644N probably damaging Het
Zfp811 T C 17: 32,798,847 D73G possibly damaging Het
Zfp951 A T 5: 104,814,972 C243S probably benign Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCTTTTAACACCAGGTC -3'
(R):5'- TACTGTGCATGAATGGGTAGAG -3'

Sequencing Primer
(F):5'- GTCTGGAATTACCTACCCCTCAGAG -3'
(R):5'- GCATGAATGGGTAGAGTTGATATAAC -3'
Posted On2019-12-27