Incidental Mutation 'R0671:Mycbp2'
ID 61476
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene Name MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms Phr1, Pam, C130061D10Rik
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0671 (G1)
Quality Score 171
Status Validated
Chromosome 14
Chromosomal Location 103350847-103584250 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103432024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 2338 (M2338K)
Ref Sequence ENSEMBL: ENSMUSP00000124601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000159855
AA Change: M2371K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: M2371K

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160758
AA Change: M2338K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: M2338K

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161278
SMART Domains Protein: ENSMUSP00000125189
Gene: ENSMUSG00000033004

DomainStartEndE-ValueType
Blast:IG_FLMN 2 66 1e-37 BLAST
SCOP:d1qfha1 14 64 2e-7 SMART
Pfam:SH3_3 98 165 5.8e-10 PFAM
internal_repeat_1 213 280 8.77e-8 PROSPERO
low complexity region 302 311 N/A INTRINSIC
low complexity region 485 518 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
Meta Mutation Damage Score 0.7984 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103,460,486 (GRCm39) missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103,393,244 (GRCm39) missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103,438,788 (GRCm39) missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103,432,057 (GRCm39) missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103,364,189 (GRCm39) missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103,528,719 (GRCm39) splice site probably benign
IGL00960:Mycbp2 APN 14 103,466,820 (GRCm39) missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103,410,078 (GRCm39) missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103,359,983 (GRCm39) missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103,392,946 (GRCm39) missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103,466,928 (GRCm39) splice site probably null
IGL01586:Mycbp2 APN 14 103,378,305 (GRCm39) critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103,528,723 (GRCm39) critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103,365,415 (GRCm39) missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103,372,640 (GRCm39) nonsense probably null
IGL01820:Mycbp2 APN 14 103,425,937 (GRCm39) missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103,380,647 (GRCm39) missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103,392,343 (GRCm39) nonsense probably null
IGL02178:Mycbp2 APN 14 103,461,802 (GRCm39) missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103,479,643 (GRCm39) missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103,551,811 (GRCm39) missense probably benign
IGL02607:Mycbp2 APN 14 103,522,709 (GRCm39) missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103,442,621 (GRCm39) missense probably benign
IGL02702:Mycbp2 APN 14 103,457,560 (GRCm39) missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103,392,697 (GRCm39) missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103,351,678 (GRCm39) splice site probably benign
IGL02866:Mycbp2 APN 14 103,367,428 (GRCm39) missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103,414,715 (GRCm39) missense probably benign
IGL03082:Mycbp2 APN 14 103,441,805 (GRCm39) missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103,536,212 (GRCm39) missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103,392,889 (GRCm39) missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103,536,134 (GRCm39) missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103,426,025 (GRCm39) missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103,485,194 (GRCm39) missense probably damaging 1.00
compost UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
decompose UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
moulder UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103,461,898 (GRCm39) splice site probably benign
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103,389,578 (GRCm39) missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103,394,070 (GRCm39) unclassified probably benign
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103,551,761 (GRCm39) nonsense probably null
R0388:Mycbp2 UTSW 14 103,394,103 (GRCm39) missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103,372,569 (GRCm39) missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103,419,895 (GRCm39) missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103,433,827 (GRCm39) unclassified probably benign
R0755:Mycbp2 UTSW 14 103,412,230 (GRCm39) missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103,457,449 (GRCm39) missense probably benign
R0903:Mycbp2 UTSW 14 103,513,293 (GRCm39) missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103,500,129 (GRCm39) unclassified probably benign
R0961:Mycbp2 UTSW 14 103,422,271 (GRCm39) missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103,378,353 (GRCm39) missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103,412,262 (GRCm39) missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103,437,588 (GRCm39) nonsense probably null
R1211:Mycbp2 UTSW 14 103,357,999 (GRCm39) missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103,446,218 (GRCm39) missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103,393,334 (GRCm39) missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103,536,303 (GRCm39) splice site probably benign
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103,441,825 (GRCm39) missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103,470,033 (GRCm39) missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103,407,287 (GRCm39) splice site probably null
R1565:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103,485,194 (GRCm39) missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103,464,947 (GRCm39) missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103,461,852 (GRCm39) missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103,419,855 (GRCm39) missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103,393,150 (GRCm39) missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103,422,319 (GRCm39) missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103,466,840 (GRCm39) missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103,383,407 (GRCm39) missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103,485,839 (GRCm39) missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103,497,675 (GRCm39) missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103,469,960 (GRCm39) critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103,524,696 (GRCm39) missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103,457,512 (GRCm39) missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103,438,666 (GRCm39) missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,383,378 (GRCm39) missense probably benign
R2146:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103,407,291 (GRCm39) critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103,407,295 (GRCm39) missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103,500,185 (GRCm39) missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103,381,774 (GRCm39) missense probably null 0.66
R2379:Mycbp2 UTSW 14 103,412,386 (GRCm39) missense probably benign
R2495:Mycbp2 UTSW 14 103,437,554 (GRCm39) missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103,368,681 (GRCm39) missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103,392,691 (GRCm39) missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103,534,794 (GRCm39) missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103,446,179 (GRCm39) splice site probably benign
R3404:Mycbp2 UTSW 14 103,437,550 (GRCm39) missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103,372,553 (GRCm39) missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103,466,866 (GRCm39) missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103,393,850 (GRCm39) missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103,371,224 (GRCm39) missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103,434,721 (GRCm39) missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103,412,233 (GRCm39) missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103,364,149 (GRCm39) missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103,441,936 (GRCm39) missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103,532,688 (GRCm39) missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103,376,161 (GRCm39) splice site probably benign
R4021:Mycbp2 UTSW 14 103,389,593 (GRCm39) missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103,485,893 (GRCm39) missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103,360,881 (GRCm39) missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103,524,664 (GRCm39) missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103,372,702 (GRCm39) missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103,371,225 (GRCm39) missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103,425,938 (GRCm39) missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103,393,094 (GRCm39) missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103,583,733 (GRCm39) missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103,414,749 (GRCm39) missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103,426,027 (GRCm39) missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103,457,380 (GRCm39) missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103,466,873 (GRCm39) missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103,448,731 (GRCm39) missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103,383,382 (GRCm39) missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103,524,675 (GRCm39) missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103,497,821 (GRCm39) splice site probably null
R4994:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign
R5029:Mycbp2 UTSW 14 103,393,946 (GRCm39) missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103,534,375 (GRCm39) missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103,376,671 (GRCm39) critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103,583,650 (GRCm39) critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103,583,757 (GRCm39) missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103,423,119 (GRCm39) critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103,479,868 (GRCm39) nonsense probably null
R5414:Mycbp2 UTSW 14 103,543,697 (GRCm39) missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103,438,837 (GRCm39) missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103,437,562 (GRCm39) missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103,479,615 (GRCm39) missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103,411,250 (GRCm39) missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103,532,673 (GRCm39) missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103,520,081 (GRCm39) nonsense probably null
R5569:Mycbp2 UTSW 14 103,372,679 (GRCm39) missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103,380,203 (GRCm39) missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103,528,769 (GRCm39) missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103,432,113 (GRCm39) missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103,426,051 (GRCm39) critical splice acceptor site probably null
R5645:Mycbp2 UTSW 14 103,426,044 (GRCm39) missense probably damaging 1.00
R5646:Mycbp2 UTSW 14 103,407,346 (GRCm39) missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103,528,778 (GRCm39) missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103,520,101 (GRCm39) missense probably null 0.99
R5668:Mycbp2 UTSW 14 103,357,955 (GRCm39) missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103,385,986 (GRCm39) missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103,371,410 (GRCm39) missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103,361,839 (GRCm39) missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103,364,120 (GRCm39) missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103,394,159 (GRCm39) missense probably benign
R6063:Mycbp2 UTSW 14 103,372,582 (GRCm39) missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103,460,482 (GRCm39) missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103,513,323 (GRCm39) missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103,522,836 (GRCm39) missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103,392,945 (GRCm39) nonsense probably null
R6161:Mycbp2 UTSW 14 103,536,183 (GRCm39) missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103,384,453 (GRCm39) missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103,497,665 (GRCm39) missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103,392,862 (GRCm39) missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103,500,176 (GRCm39) missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103,393,288 (GRCm39) missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103,392,911 (GRCm39) missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103,373,993 (GRCm39) critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103,380,317 (GRCm39) missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103,429,003 (GRCm39) missense probably null 1.00
R6821:Mycbp2 UTSW 14 103,376,845 (GRCm39) missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103,497,630 (GRCm39) critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103,522,703 (GRCm39) missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103,392,342 (GRCm39) missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103,444,117 (GRCm39) missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103,412,417 (GRCm39) missense probably benign
R7054:Mycbp2 UTSW 14 103,393,534 (GRCm39) missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103,360,039 (GRCm39) missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103,391,513 (GRCm39) missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103,520,115 (GRCm39) missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103,497,636 (GRCm39) missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103,371,282 (GRCm39) missense probably benign
R7234:Mycbp2 UTSW 14 103,452,773 (GRCm39) missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103,393,733 (GRCm39) missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103,446,345 (GRCm39) missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103,434,679 (GRCm39) critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103,358,027 (GRCm39) missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103,434,793 (GRCm39) missense probably damaging 0.97
R7332:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
R7384:Mycbp2 UTSW 14 103,513,829 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,480,564 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,389,627 (GRCm39) missense probably damaging 1.00
R7409:Mycbp2 UTSW 14 103,526,180 (GRCm39) missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103,434,690 (GRCm39) missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103,583,701 (GRCm39) missense probably benign
R7661:Mycbp2 UTSW 14 103,450,059 (GRCm39) missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103,429,045 (GRCm39) missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103,429,055 (GRCm39) missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103,485,840 (GRCm39) missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103,364,533 (GRCm39) missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103,376,851 (GRCm39) missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103,414,729 (GRCm39) missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103,384,267 (GRCm39) critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103,393,741 (GRCm39) missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103,393,582 (GRCm39) missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103,437,621 (GRCm39) missense probably damaging 0.99
R7942:Mycbp2 UTSW 14 103,392,674 (GRCm39) missense probably damaging 0.99
R7951:Mycbp2 UTSW 14 103,452,898 (GRCm39) missense probably damaging 0.99
R7958:Mycbp2 UTSW 14 103,367,400 (GRCm39) missense probably benign 0.00
R8235:Mycbp2 UTSW 14 103,436,110 (GRCm39) missense probably damaging 0.99
R8246:Mycbp2 UTSW 14 103,392,640 (GRCm39) missense probably damaging 0.99
R8338:Mycbp2 UTSW 14 103,372,701 (GRCm39) missense probably damaging 1.00
R8343:Mycbp2 UTSW 14 103,398,111 (GRCm39) splice site probably null
R8361:Mycbp2 UTSW 14 103,376,250 (GRCm39) missense probably damaging 1.00
R8490:Mycbp2 UTSW 14 103,446,267 (GRCm39) missense probably benign 0.00
R8524:Mycbp2 UTSW 14 103,392,895 (GRCm39) missense probably benign 0.23
R8525:Mycbp2 UTSW 14 103,450,155 (GRCm39) missense probably damaging 1.00
R8711:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign 0.08
R8735:Mycbp2 UTSW 14 103,460,586 (GRCm39) missense probably damaging 0.99
R8825:Mycbp2 UTSW 14 103,466,871 (GRCm39) missense probably damaging 1.00
R8928:Mycbp2 UTSW 14 103,393,781 (GRCm39) missense probably benign
R8974:Mycbp2 UTSW 14 103,361,857 (GRCm39) missense probably damaging 1.00
R8987:Mycbp2 UTSW 14 103,446,232 (GRCm39) missense probably damaging 1.00
R9021:Mycbp2 UTSW 14 103,551,752 (GRCm39) missense probably benign 0.08
R9062:Mycbp2 UTSW 14 103,479,796 (GRCm39) missense probably benign 0.00
R9077:Mycbp2 UTSW 14 103,469,974 (GRCm39) missense probably damaging 1.00
R9208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.01
R9285:Mycbp2 UTSW 14 103,434,753 (GRCm39) missense probably damaging 0.97
R9290:Mycbp2 UTSW 14 103,425,960 (GRCm39) missense probably damaging 0.99
R9362:Mycbp2 UTSW 14 103,497,642 (GRCm39) missense probably damaging 0.97
R9520:Mycbp2 UTSW 14 103,497,705 (GRCm39) missense probably benign 0.02
R9557:Mycbp2 UTSW 14 103,372,697 (GRCm39) missense probably benign 0.03
R9639:Mycbp2 UTSW 14 103,433,817 (GRCm39) missense probably damaging 1.00
R9666:Mycbp2 UTSW 14 103,371,474 (GRCm39) missense probably damaging 0.98
R9732:Mycbp2 UTSW 14 103,448,749 (GRCm39) missense probably damaging 1.00
R9736:Mycbp2 UTSW 14 103,434,852 (GRCm39) missense probably damaging 0.96
R9739:Mycbp2 UTSW 14 103,520,229 (GRCm39) missense probably benign 0.11
R9755:Mycbp2 UTSW 14 103,551,806 (GRCm39) missense probably benign
X0024:Mycbp2 UTSW 14 103,384,378 (GRCm39) missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103,583,685 (GRCm39) missense probably benign
Z1176:Mycbp2 UTSW 14 103,394,073 (GRCm39) missense probably benign 0.06
Z1177:Mycbp2 UTSW 14 103,407,309 (GRCm39) missense possibly damaging 0.83
Z1177:Mycbp2 UTSW 14 103,372,559 (GRCm39) missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103,364,499 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACTCAGCATGATTCCAGGGGTAG -3'
(R):5'- GAAGTGTCAAGGGCAACTGTGTTTG -3'

Sequencing Primer
(F):5'- GACAAGCACTTCAGCTTTAGGTC -3'
(R):5'- GAAAGCTGTACCTGTTTCTCAG -3'
Posted On 2013-07-30