Incidental Mutation 'R7978:Cntnap4'
ID614782
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Namecontactin associated protein-like 4
SynonymsE130114F09Rik, Caspr4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location112570043-112882717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112752197 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 185 (V185E)
Ref Sequence ENSEMBL: ENSMUSP00000034225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: V185E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: V185E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: V185E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: V185E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,510 S143T probably benign Het
Agpat3 T A 10: 78,283,200 I187F probably benign Het
Ahcyl1 C T 3: 107,669,151 A332T probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Ap5z1 T A 5: 142,470,558 probably null Het
Apob A T 12: 8,011,933 I3472F probably benign Het
Arhgef4 T C 1: 34,806,397 I130T probably damaging Het
Arnt2 A T 7: 84,305,198 F263I probably benign Het
Bbof1 A G 12: 84,419,989 R177G probably damaging Het
Bbs2 C A 8: 94,081,136 G372W probably damaging Het
Blmh T A 11: 76,945,895 probably null Het
Ccdc30 A T 4: 119,352,713 probably null Het
Cdca7l G T 12: 117,873,732 L219F probably damaging Het
Cenpu C A 8: 46,562,464 A138E probably benign Het
Cfap65 T A 1: 74,933,162 T13S probably benign Het
Clasp2 A G 9: 113,903,948 M951V probably benign Het
Clca4a A G 3: 144,968,405 S190P probably benign Het
Clcn4 A G 7: 7,295,168 V74A probably benign Het
Cntln C T 4: 85,063,324 T913M possibly damaging Het
Col26a1 C T 5: 136,748,177 probably null Het
Ctcf A T 8: 105,664,058 Q99L possibly damaging Het
Dgke T C 11: 89,040,856 Q524R probably damaging Het
Dhrs7 A T 12: 72,652,460 probably null Het
Dnah7b T C 1: 46,249,950 Y2969H probably damaging Het
Dync1h1 T G 12: 110,616,457 I358S probably damaging Het
Efcab3 A C 11: 105,117,324 D410A probably benign Het
Emilin2 T C 17: 71,273,913 D606G probably benign Het
Ermard C T 17: 15,063,613 T622I possibly damaging Het
Exo1 A G 1: 175,900,996 D542G probably benign Het
Fgd5 A T 6: 91,987,281 D165V probably benign Het
Gdap1 T C 1: 17,161,144 W238R probably damaging Het
Gm11096 T G 17: 81,441,899 I7M unknown Het
Gm436 A T 4: 144,670,343 I273K possibly damaging Het
Gmppb A T 9: 108,050,571 M175L probably benign Het
Gorasp2 G A 2: 70,684,098 S273N probably benign Het
Gtf3c1 T C 7: 125,672,822 M642V possibly damaging Het
Hmx2 T A 7: 131,555,871 L238Q probably damaging Het
Kif13b A G 14: 64,736,149 D316G probably damaging Het
Kmt2c A G 5: 25,373,176 S701P possibly damaging Het
Lama4 T A 10: 39,088,329 N1332K probably damaging Het
Lrp2 T C 2: 69,458,479 D3681G probably damaging Het
Maml3 G T 3: 51,697,722 P722Q probably damaging Het
Mier2 C A 10: 79,541,885 probably benign Het
Ms4a15 A T 19: 10,979,330 probably null Het
Msh5 T C 17: 35,044,379 M158V probably benign Het
Nova2 A T 7: 18,942,345 K136I Het
Npm1 A T 11: 33,156,001 probably null Het
Nr4a3 T A 4: 48,051,390 M48K probably benign Het
Nrap T G 19: 56,354,152 T806P probably benign Het
Ntf3 G A 6: 126,102,240 T101M probably benign Het
Olfr169 G A 16: 19,566,722 R54* probably null Het
Paxbp1 T A 16: 91,025,278 D648V probably damaging Het
Pcdhb18 T A 18: 37,490,467 D283E probably benign Het
Phrf1 C A 7: 141,259,375 Q828K unknown Het
Pigq A T 17: 25,937,325 I43N probably benign Het
Pou6f2 G T 13: 18,125,448 T542K Het
Ppfibp2 T A 7: 107,721,317 probably null Het
Rab1b A T 19: 5,100,496 M163K probably benign Het
Ralgapa1 A G 12: 55,747,149 M567T probably benign Het
Reck T C 4: 43,890,970 V36A probably benign Het
Resp18 C T 1: 75,278,202 D36N probably null Het
Rint1 A C 5: 23,800,722 H134P probably damaging Het
Rps19 A T 7: 24,888,339 K77M possibly damaging Het
Sec24b A T 3: 129,995,949 S808T probably benign Het
Sema4c A C 1: 36,553,118 V216G probably damaging Het
Sept10 T A 10: 59,181,049 T218S probably benign Het
Sept3 A T 15: 82,285,819 H182L probably benign Het
Sipa1 A G 19: 5,652,662 S836P probably benign Het
Slc9a5 A G 8: 105,363,366 K652R probably damaging Het
Slco5a1 T A 1: 12,989,703 I265F possibly damaging Het
Snapc5 T A 9: 64,179,332 M1K probably null Het
Snx5 T A 2: 144,253,820 D307V possibly damaging Het
Srebf2 A T 15: 82,177,240 M381L probably benign Het
Ssh2 G C 11: 77,454,626 E1146Q probably benign Het
Suco A T 1: 161,845,368 probably null Het
Tanc2 T A 11: 105,921,825 L1365Q probably damaging Het
Tas1r3 A G 4: 155,862,548 L200P probably damaging Het
Thbs2 T G 17: 14,676,221 D802A probably damaging Het
Trav3-1 G A 14: 52,581,093 V75M probably benign Het
Trim9 G A 12: 70,255,187 P559L probably benign Het
Trpc6 G A 9: 8,655,218 G683D probably damaging Het
Unc5b C A 10: 60,779,730 V164L possibly damaging Het
Usf3 A T 16: 44,216,202 R348S possibly damaging Het
Vmn1r236 T C 17: 21,287,466 V282A possibly damaging Het
Vmn2r1 A G 3: 64,089,709 E262G possibly damaging Het
Xirp2 A G 2: 67,509,497 E694G probably damaging Het
Xpo4 T A 14: 57,602,591 H572L probably benign Het
Zfhx4 A G 3: 5,242,199 T162A probably benign Het
Zfp110 T A 7: 12,837,093 H59Q possibly damaging Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 112767619 splice site probably benign
IGL01898:Cntnap4 APN 8 112856307 missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 112752234 missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 112616494 missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 112785903 splice site probably benign
IGL02621:Cntnap4 APN 8 112810723 missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 112773590 missense probably benign 0.06
IGL03327:Cntnap4 APN 8 112773576 missense probably benign 0.00
IGL03346:Cntnap4 APN 8 112773576 missense probably benign 0.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 112785784 missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 112842516 critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 112856511 nonsense probably null
R0497:Cntnap4 UTSW 8 112570151 missense probably benign 0.00
R1495:Cntnap4 UTSW 8 112881763 missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 112881830 missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 112757523 missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 112815496 missense probably benign 0.10
R2160:Cntnap4 UTSW 8 112757571 missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 112757439 missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R3917:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R4097:Cntnap4 UTSW 8 112752307 missense probably benign 0.03
R4348:Cntnap4 UTSW 8 112753922 missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 112665266 missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 112858210 missense probably benign 0.32
R4531:Cntnap4 UTSW 8 112810608 missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 112810710 missense probably benign
R4611:Cntnap4 UTSW 8 112773739 critical splice donor site probably null
R4675:Cntnap4 UTSW 8 112785836 missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 112733438 missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 112841753 missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 112875429 missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 112842721 missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 112803211 missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 112752289 missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 112757473 missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 112803226 missense probably benign 0.03
R7031:Cntnap4 UTSW 8 112858242 missense probably benign 0.01
R7107:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 112810636 missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 112881800 missense probably benign 0.05
R7232:Cntnap4 UTSW 8 112665099 splice site probably null
R7348:Cntnap4 UTSW 8 112665277 missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 112733562 critical splice donor site probably null
R7832:Cntnap4 UTSW 8 112757481 missense probably benign
R7895:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R7915:Cntnap4 UTSW 8 112757481 missense probably benign
R8014:Cntnap4 UTSW 8 112753945 missense probably damaging 0.99
X0025:Cntnap4 UTSW 8 112859143 missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 112875579 missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 112815520 missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 112858189 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGTTGGTCTGACATCACACAC -3'
(R):5'- GCCTCACCAAGCAGTTTTAC -3'

Sequencing Primer
(F):5'- GTTGGTCTGACATCACACACATTCAC -3'
(R):5'- GTGATATGATCTCCAGCAG -3'
Posted On2019-12-27