Incidental Mutation 'R7978:Nrap'
ID614827
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Namenebulin-related anchoring protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56320035-56390037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56354152 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 806 (T806P)
Ref Sequence ENSEMBL: ENSMUSP00000073228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
Predicted Effect probably benign
Transcript: ENSMUST00000040711
AA Change: T771P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: T771P

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073536
AA Change: T806P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: T806P

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095947
AA Change: T689P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134
AA Change: T689P

DomainStartEndE-ValueType
NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166203
AA Change: T770P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: T770P

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167239
AA Change: T771P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: T771P

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169099
SMART Domains Protein: ENSMUSP00000125889
Gene: ENSMUSG00000049134

DomainStartEndE-ValueType
NEBU 32 61 2.83e-6 SMART
NEBU 70 100 7.24e-4 SMART
NEBU 105 135 3.46e-1 SMART
NEBU 141 171 1.18e-3 SMART
NEBU 209 239 8.97e-9 SMART
NEBU 244 274 1.73e-10 SMART
NEBU 280 310 8.12e-7 SMART
NEBU 314 344 1.73e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,510 S143T probably benign Het
Agpat3 T A 10: 78,283,200 I187F probably benign Het
Ahcyl1 C T 3: 107,669,151 A332T probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Ap5z1 T A 5: 142,470,558 probably null Het
Apob A T 12: 8,011,933 I3472F probably benign Het
Arhgef4 T C 1: 34,806,397 I130T probably damaging Het
Arnt2 A T 7: 84,305,198 F263I probably benign Het
Bbof1 A G 12: 84,419,989 R177G probably damaging Het
Bbs2 C A 8: 94,081,136 G372W probably damaging Het
Blmh T A 11: 76,945,895 probably null Het
Ccdc30 A T 4: 119,352,713 probably null Het
Cdca7l G T 12: 117,873,732 L219F probably damaging Het
Cenpu C A 8: 46,562,464 A138E probably benign Het
Cfap65 T A 1: 74,933,162 T13S probably benign Het
Clasp2 A G 9: 113,903,948 M951V probably benign Het
Clca4a A G 3: 144,968,405 S190P probably benign Het
Clcn4 A G 7: 7,295,168 V74A probably benign Het
Cntln C T 4: 85,063,324 T913M possibly damaging Het
Cntnap4 T A 8: 112,752,197 V185E probably damaging Het
Col26a1 C T 5: 136,748,177 probably null Het
Ctcf A T 8: 105,664,058 Q99L possibly damaging Het
Dgke T C 11: 89,040,856 Q524R probably damaging Het
Dhrs7 A T 12: 72,652,460 probably null Het
Dnah7b T C 1: 46,249,950 Y2969H probably damaging Het
Dync1h1 T G 12: 110,616,457 I358S probably damaging Het
Efcab3 A C 11: 105,117,324 D410A probably benign Het
Emilin2 T C 17: 71,273,913 D606G probably benign Het
Ermard C T 17: 15,063,613 T622I possibly damaging Het
Exo1 A G 1: 175,900,996 D542G probably benign Het
Fgd5 A T 6: 91,987,281 D165V probably benign Het
Gdap1 T C 1: 17,161,144 W238R probably damaging Het
Gm11096 T G 17: 81,441,899 I7M unknown Het
Gm436 A T 4: 144,670,343 I273K possibly damaging Het
Gmppb A T 9: 108,050,571 M175L probably benign Het
Gorasp2 G A 2: 70,684,098 S273N probably benign Het
Gtf3c1 T C 7: 125,672,822 M642V possibly damaging Het
Hmx2 T A 7: 131,555,871 L238Q probably damaging Het
Kif13b A G 14: 64,736,149 D316G probably damaging Het
Kmt2c A G 5: 25,373,176 S701P possibly damaging Het
Lama4 T A 10: 39,088,329 N1332K probably damaging Het
Lrp2 T C 2: 69,458,479 D3681G probably damaging Het
Maml3 G T 3: 51,697,722 P722Q probably damaging Het
Mier2 C A 10: 79,541,885 probably benign Het
Ms4a15 A T 19: 10,979,330 probably null Het
Msh5 T C 17: 35,044,379 M158V probably benign Het
Nova2 A T 7: 18,942,345 K136I Het
Npm1 A T 11: 33,156,001 probably null Het
Nr4a3 T A 4: 48,051,390 M48K probably benign Het
Ntf3 G A 6: 126,102,240 T101M probably benign Het
Olfr169 G A 16: 19,566,722 R54* probably null Het
Paxbp1 T A 16: 91,025,278 D648V probably damaging Het
Pcdhb18 T A 18: 37,490,467 D283E probably benign Het
Phrf1 C A 7: 141,259,375 Q828K unknown Het
Pigq A T 17: 25,937,325 I43N probably benign Het
Pou6f2 G T 13: 18,125,448 T542K Het
Ppfibp2 T A 7: 107,721,317 probably null Het
Rab1b A T 19: 5,100,496 M163K probably benign Het
Ralgapa1 A G 12: 55,747,149 M567T probably benign Het
Reck T C 4: 43,890,970 V36A probably benign Het
Resp18 C T 1: 75,278,202 D36N probably null Het
Rint1 A C 5: 23,800,722 H134P probably damaging Het
Rps19 A T 7: 24,888,339 K77M possibly damaging Het
Sec24b A T 3: 129,995,949 S808T probably benign Het
Sema4c A C 1: 36,553,118 V216G probably damaging Het
Sept10 T A 10: 59,181,049 T218S probably benign Het
Sept3 A T 15: 82,285,819 H182L probably benign Het
Sipa1 A G 19: 5,652,662 S836P probably benign Het
Slc9a5 A G 8: 105,363,366 K652R probably damaging Het
Slco5a1 T A 1: 12,989,703 I265F possibly damaging Het
Snapc5 T A 9: 64,179,332 M1K probably null Het
Snx5 T A 2: 144,253,820 D307V possibly damaging Het
Srebf2 A T 15: 82,177,240 M381L probably benign Het
Ssh2 G C 11: 77,454,626 E1146Q probably benign Het
Suco A T 1: 161,845,368 probably null Het
Tanc2 T A 11: 105,921,825 L1365Q probably damaging Het
Tas1r3 A G 4: 155,862,548 L200P probably damaging Het
Thbs2 T G 17: 14,676,221 D802A probably damaging Het
Trav3-1 G A 14: 52,581,093 V75M probably benign Het
Trim9 G A 12: 70,255,187 P559L probably benign Het
Trpc6 G A 9: 8,655,218 G683D probably damaging Het
Unc5b C A 10: 60,779,730 V164L possibly damaging Het
Usf3 A T 16: 44,216,202 R348S possibly damaging Het
Vmn1r236 T C 17: 21,287,466 V282A possibly damaging Het
Vmn2r1 A G 3: 64,089,709 E262G possibly damaging Het
Xirp2 A G 2: 67,509,497 E694G probably damaging Het
Xpo4 T A 14: 57,602,591 H572L probably benign Het
Zfhx4 A G 3: 5,242,199 T162A probably benign Het
Zfp110 T A 7: 12,837,093 H59Q possibly damaging Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56372909 missense probably damaging 1.00
IGL00570:Nrap APN 19 56338113 missense probably benign 0.10
IGL00946:Nrap APN 19 56340626 splice site probably null
IGL01070:Nrap APN 19 56329084 missense probably damaging 1.00
IGL01111:Nrap APN 19 56345558 missense probably damaging 1.00
IGL01138:Nrap APN 19 56355538 missense probably damaging 1.00
IGL01290:Nrap APN 19 56361748 missense probably damaging 1.00
IGL01352:Nrap APN 19 56379836 missense probably benign 0.00
IGL01372:Nrap APN 19 56329102 critical splice acceptor site probably null
IGL01395:Nrap APN 19 56361793 missense probably damaging 1.00
IGL01413:Nrap APN 19 56389391 missense probably damaging 0.99
IGL01734:Nrap APN 19 56350309 missense probably damaging 1.00
IGL01933:Nrap APN 19 56388818 missense probably damaging 1.00
IGL02156:Nrap APN 19 56321000 missense probably damaging 1.00
IGL02415:Nrap APN 19 56382309 missense probably damaging 1.00
IGL02447:Nrap APN 19 56345519 nonsense probably null
IGL02864:Nrap APN 19 56350374 missense probably damaging 1.00
IGL02993:Nrap APN 19 56345533 missense probably damaging 1.00
IGL03003:Nrap APN 19 56321952 missense probably damaging 1.00
IGL03006:Nrap APN 19 56347164 missense probably benign 0.02
IGL03084:Nrap APN 19 56365454 missense probably damaging 1.00
IGL03136:Nrap APN 19 56342255 missense possibly damaging 0.69
IGL03272:Nrap APN 19 56345568 intron probably benign
IGL03389:Nrap APN 19 56351716 missense probably benign 0.10
R0116:Nrap UTSW 19 56355546 missense probably damaging 1.00
R0374:Nrap UTSW 19 56351622 missense probably damaging 1.00
R0715:Nrap UTSW 19 56357325 missense probably damaging 0.98
R0828:Nrap UTSW 19 56345558 missense probably damaging 1.00
R0883:Nrap UTSW 19 56345474 missense probably damaging 1.00
R1416:Nrap UTSW 19 56327293 missense possibly damaging 0.60
R1459:Nrap UTSW 19 56384130 missense probably benign 0.00
R1616:Nrap UTSW 19 56389823 missense probably damaging 1.00
R1676:Nrap UTSW 19 56335255 missense probably damaging 1.00
R1687:Nrap UTSW 19 56355529 missense probably damaging 0.99
R1766:Nrap UTSW 19 56335042 missense probably damaging 0.99
R1792:Nrap UTSW 19 56379158 missense probably benign 0.00
R1817:Nrap UTSW 19 56384055 unclassified probably benign
R1972:Nrap UTSW 19 56357353 missense probably damaging 1.00
R1982:Nrap UTSW 19 56384105 missense probably damaging 0.99
R2258:Nrap UTSW 19 56321962 missense possibly damaging 0.80
R2448:Nrap UTSW 19 56322030 missense possibly damaging 0.90
R3034:Nrap UTSW 19 56364005 missense probably damaging 1.00
R3801:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3804:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3923:Nrap UTSW 19 56380256 missense probably damaging 0.99
R3964:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3965:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3966:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3980:Nrap UTSW 19 56381552 missense probably benign 0.01
R4182:Nrap UTSW 19 56350327 missense probably damaging 1.00
R4499:Nrap UTSW 19 56351481 missense probably damaging 0.97
R4573:Nrap UTSW 19 56342338 critical splice acceptor site probably null
R4603:Nrap UTSW 19 56335024 critical splice donor site probably null
R4689:Nrap UTSW 19 56386026 missense probably damaging 0.97
R4749:Nrap UTSW 19 56380237 missense probably damaging 0.96
R4845:Nrap UTSW 19 56351470 missense probably benign 0.16
R4937:Nrap UTSW 19 56347220 missense probably damaging 1.00
R4962:Nrap UTSW 19 56378143 missense probably damaging 1.00
R5156:Nrap UTSW 19 56371845 missense possibly damaging 0.94
R5181:Nrap UTSW 19 56345528 missense possibly damaging 0.85
R5202:Nrap UTSW 19 56335151 missense probably damaging 1.00
R5262:Nrap UTSW 19 56320223 missense possibly damaging 0.95
R5301:Nrap UTSW 19 56379109 missense probably damaging 1.00
R5380:Nrap UTSW 19 56381603 missense probably damaging 1.00
R5576:Nrap UTSW 19 56321982 missense probably damaging 0.99
R5631:Nrap UTSW 19 56354121 missense probably benign 0.19
R5754:Nrap UTSW 19 56389484 missense possibly damaging 0.55
R5799:Nrap UTSW 19 56342169 nonsense probably null
R5899:Nrap UTSW 19 56340574 missense possibly damaging 0.80
R5910:Nrap UTSW 19 56342311 missense probably benign 0.00
R5994:Nrap UTSW 19 56351599 nonsense probably null
R6124:Nrap UTSW 19 56386026 missense probably damaging 0.97
R6149:Nrap UTSW 19 56389453 missense possibly damaging 0.79
R6182:Nrap UTSW 19 56361698 missense probably benign
R6245:Nrap UTSW 19 56354221 missense probably damaging 1.00
R6245:Nrap UTSW 19 56379875 missense possibly damaging 0.80
R6270:Nrap UTSW 19 56320198 missense probably benign 0.00
R6274:Nrap UTSW 19 56361721 missense probably benign 0.21
R6340:Nrap UTSW 19 56347184 missense probably damaging 1.00
R6547:Nrap UTSW 19 56351566 missense probably benign 0.00
R6734:Nrap UTSW 19 56345509 missense probably damaging 0.99
R6770:Nrap UTSW 19 56382537 intron probably null
R6812:Nrap UTSW 19 56351676 missense probably damaging 1.00
R6843:Nrap UTSW 19 56380219 missense probably damaging 1.00
R7207:Nrap UTSW 19 56345521 missense probably damaging 1.00
R7214:Nrap UTSW 19 56378135 missense probably benign 0.09
R7313:Nrap UTSW 19 56342268 missense probably damaging 0.97
R7515:Nrap UTSW 19 56366427 missense possibly damaging 0.94
R7662:Nrap UTSW 19 56320283 missense probably benign 0.00
R7819:Nrap UTSW 19 56335288 missense probably benign
R7836:Nrap UTSW 19 56350297 missense probably benign 0.00
R7895:Nrap UTSW 19 56354152 missense probably benign 0.00
R7919:Nrap UTSW 19 56350297 missense probably benign 0.00
R8041:Nrap UTSW 19 56364336 nonsense probably null
R8046:Nrap UTSW 19 56320251 missense possibly damaging 0.46
R8066:Nrap UTSW 19 56354130 missense possibly damaging 0.94
X0028:Nrap UTSW 19 56335220 nonsense probably null
Z1176:Nrap UTSW 19 56345517 frame shift probably null
Z1177:Nrap UTSW 19 56338092 missense probably damaging 1.00
Z1177:Nrap UTSW 19 56344764 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATTTGGGGAGACGATGCTC -3'
(R):5'- GCTCAGAAAGGTTTTCACAGAGTC -3'

Sequencing Primer
(F):5'- ACGATGCTCCTGCCTAGGTAG -3'
(R):5'- CCCAGGGGTCATATATTAGAATGTCC -3'
Posted On2019-12-27