Incidental Mutation 'R0671:Kalrn'
ID61483
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 038856-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R0671 (G1)
Quality Score159
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34116408 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1636 (S1636G)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114961] [ENSMUST00000114963]
PDB Structure
Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: S1636G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: S1636G

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114963
AA Change: S36G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: S36G

DomainStartEndE-ValueType
SH3 22 83 1.23e-7 SMART
RhoGEF 273 443 1.47e-52 SMART
PH 463 568 9.87e-4 SMART
SH3 664 725 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142817
AA Change: S1631G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: S1631G

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 probably benign Het
4930430A15Rik A C 2: 111,204,137 V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 T31I probably benign Het
Abca17 A G 17: 24,281,249 F1323L probably benign Het
Abcf3 T A 16: 20,550,487 N206K probably damaging Het
Adam10 A G 9: 70,765,941 probably benign Het
Adamtsl3 A T 7: 82,523,182 Q451L probably damaging Het
Adgrl3 T A 5: 81,560,905 I413N probably benign Het
Asb18 G T 1: 89,993,171 A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 E2235G probably damaging Het
Blnk G T 19: 40,937,667 S330* probably null Het
Bpnt1 T G 1: 185,356,611 N319K probably benign Het
Brip1 G A 11: 86,152,667 T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 D288E probably benign Het
Calcoco2 A G 11: 96,107,528 V23A probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 probably benign Het
Cdk12 T C 11: 98,230,109 probably benign Het
Clec4a3 A G 6: 122,954,034 probably null Het
Cpne2 T A 8: 94,548,342 probably benign Het
Cyfip1 T C 7: 55,923,962 probably null Het
Cyp26c1 A G 19: 37,686,561 H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Defb43 T A 14: 63,011,838 V10D probably damaging Het
Dhx36 G A 3: 62,493,741 S368L possibly damaging Het
Dock6 G A 9: 21,804,627 probably benign Het
Elp2 T C 18: 24,612,442 probably benign Het
Emilin3 A G 2: 160,908,329 L453P probably damaging Het
Eml6 A T 11: 29,805,065 D903E probably benign Het
Ep300 T C 15: 81,616,134 probably benign Het
Ep400 G A 5: 110,688,196 T1899M unknown Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fbxo42 G A 4: 141,195,239 V239M probably damaging Het
Fermt2 T C 14: 45,469,319 D340G probably benign Het
Filip1 A T 9: 79,819,390 V649E probably damaging Het
Fut8 G A 12: 77,475,017 E477K probably damaging Het
Gbp3 G A 3: 142,565,390 G185D probably benign Het
Gclc G T 9: 77,786,798 D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 D43G possibly damaging Het
Gm960 A G 19: 4,626,188 S639P probably damaging Het
Gnptab A G 10: 88,443,304 probably benign Het
Greb1l C T 18: 10,474,303 T206I probably damaging Het
Grk4 A G 5: 34,748,267 N452S probably benign Het
Hcn2 G C 10: 79,734,232 probably null Het
Hpn T C 7: 31,109,160 K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 D3268G probably damaging Het
Immt A T 6: 71,871,557 Q467L possibly damaging Het
Kcnh8 T A 17: 52,978,113 L1037* probably null Het
Klhl33 T C 14: 50,892,394 T548A probably damaging Het
Klri2 T C 6: 129,740,208 I71V probably benign Het
Kmt2c A T 5: 25,404,365 C254S probably damaging Het
Lama3 T C 18: 12,477,590 I1170T possibly damaging Het
Med12l A G 3: 59,264,929 Q1702R probably damaging Het
Mga A T 2: 119,919,910 probably null Het
Mis18a A T 16: 90,720,673 I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 D83G probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 probably benign Het
Mrrf C T 2: 36,153,698 A149V probably benign Het
Mycbp2 A T 14: 103,194,588 M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 Q2387R probably benign Het
N4bp2 T C 5: 65,807,437 I943T probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 probably null Het
Ncor2 C T 5: 125,049,387 A136T probably benign Het
Olfr311 T A 11: 58,841,855 I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 Y282* probably null Het
Olfr539 A G 7: 140,667,677 D123G probably damaging Het
Olfr887 T A 9: 38,085,127 M97K possibly damaging Het
Opa1 T C 16: 29,602,207 probably benign Het
Pcdhb4 T C 18: 37,307,742 M35T probably benign Het
Per3 T C 4: 151,028,831 I347V probably benign Het
Pex13 G A 11: 23,665,831 P5L possibly damaging Het
Phkb T A 8: 85,875,693 W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 D247E probably benign Het
Plxnb2 A G 15: 89,157,981 S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 N196H possibly damaging Het
Rab27a G T 9: 73,075,433 D7Y probably damaging Het
Rars2 T A 4: 34,630,505 C82* probably null Het
Rccd1 A T 7: 80,320,217 probably benign Het
Riiad1 T C 3: 94,472,239 I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 E77G probably damaging Het
Rnf126 A T 10: 79,761,607 I157N possibly damaging Het
Rnf207 T C 4: 152,307,468 R623G probably benign Het
Rpusd1 T G 17: 25,728,524 F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 probably null Het
Scfd1 A T 12: 51,412,628 Q324L probably benign Het
Skint3 G T 4: 112,255,777 E195* probably null Het
Slc7a10 A T 7: 35,197,333 T165S probably benign Het
Smagp A G 15: 100,621,852 I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 H172R probably damaging Het
Spast A G 17: 74,339,451 probably benign Het
Sspo G T 6: 48,490,391 probably benign Het
Ston2 C T 12: 91,740,466 probably null Het
Tas2r103 T G 6: 133,036,350 E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 probably benign Het
Telo2 G A 17: 25,113,165 P143L probably benign Het
Tgfbi A T 13: 56,638,726 Y674F probably null Het
Tha1 T A 11: 117,873,157 probably benign Het
Timp4 T A 6: 115,249,853 S110C probably damaging Het
Tlr6 T C 5: 64,954,592 K324R probably benign Het
Tnip3 A G 6: 65,597,363 E137G probably damaging Het
Trak1 T C 9: 121,448,955 probably null Het
Trim47 A G 11: 116,108,352 S233P probably benign Het
Tspoap1 A T 11: 87,762,809 E155V probably damaging Het
Tsta3 A G 15: 75,928,958 V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 V36D probably damaging Het
Wdr27 T C 17: 14,928,396 T112A probably benign Het
Wdr90 T C 17: 25,846,393 T1630A probably benign Het
Zfp352 A G 4: 90,223,919 T99A probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGGGAAGAAGCAGTCCATTTCCAC -3'
(R):5'- GGACAATTGACAGGAAGCTTGGCAC -3'

Sequencing Primer
(F):5'- TTCCACGCTGCTGCGAG -3'
(R):5'- tcctcctcctttctcctcc -3'
Posted On2013-07-30