Incidental Mutation 'R0671:Kalrn'
ID 61483
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R0671 (G1)
Quality Score 159
Status Validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33936778 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1636 (S1636G)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114961] [ENSMUST00000114963]
AlphaFold no structure available at present
PDB Structure Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: S1636G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: S1636G

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114963
AA Change: S36G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: S36G

DomainStartEndE-ValueType
SH3 22 83 1.23e-7 SMART
RhoGEF 273 443 1.47e-52 SMART
PH 463 568 9.87e-4 SMART
SH3 664 725 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142817
AA Change: S1631G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: S1631G

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,797,894 (GRCm39) critical splice donor site probably null
R1991:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,177,785 (GRCm39) splice site probably null
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 33,834,454 (GRCm39) missense probably damaging 1.00
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,076,603 (GRCm39) missense unknown
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAAGAAGCAGTCCATTTCCAC -3'
(R):5'- GGACAATTGACAGGAAGCTTGGCAC -3'

Sequencing Primer
(F):5'- TTCCACGCTGCTGCGAG -3'
(R):5'- tcctcctcctttctcctcc -3'
Posted On 2013-07-30