Incidental Mutation 'R7979:Abcc6'
ID614858
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 6
SynonymsMrp6, DCC, Dyscalc1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R7979 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45967555-46030302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45977379 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1418 (L1418P)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: L1418P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: L1418P

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210962
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,004,958 T894A probably damaging Het
Abcc10 T A 17: 46,324,309 H256L probably benign Het
Actn2 G A 13: 12,294,317 A290V possibly damaging Het
Actrt2 A T 4: 154,667,195 D161E probably benign Het
Adam19 T A 11: 46,137,543 C668S probably damaging Het
Alg8 T C 7: 97,390,916 L435S probably damaging Het
Amz2 G A 11: 109,436,587 E322K possibly damaging Het
Ankrd12 T A 17: 65,985,685 R918* probably null Het
Atp5f1 A G 3: 105,955,943 I59T probably damaging Het
Bach1 T A 16: 87,719,005 C145S possibly damaging Het
Bcl6b G T 11: 70,227,022 S309* probably null Het
Birc6 G T 17: 74,622,082 R2323L probably damaging Het
Catspere2 A T 1: 178,111,174 M538L probably benign Het
Ccdc154 A T 17: 25,171,826 M647L probably benign Het
Cdc14a T C 3: 116,294,833 T447A probably benign Het
Chst9 C T 18: 15,452,789 R239H probably damaging Het
Cs C T 10: 128,353,135 A171V probably damaging Het
D3Ertd751e T A 3: 41,756,073 F107I probably benign Het
D430041D05Rik T C 2: 104,258,040 D197G probably benign Het
Dcdc2c G A 12: 28,470,620 Q486* probably null Het
Dolk A T 2: 30,285,949 V28E possibly damaging Het
Dpf2 C T 19: 5,904,305 S191N probably benign Het
Eml3 T A 19: 8,933,807 F267I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam189a1 T C 7: 64,776,809 H232R probably damaging Het
Foxo3 T C 10: 42,197,736 S262G possibly damaging Het
Gm1527 T G 3: 28,921,593 probably null Het
Gm49380 G A 9: 44,112,799 L51F probably damaging Het
Gm9195 A T 14: 72,455,738 H1582Q unknown Het
Gm9573 G A 17: 35,620,025 P1090S unknown Het
Grip1 A G 10: 119,978,545 Q327R possibly damaging Het
Gstt1 A G 10: 75,784,142 F207S probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kif16b A G 2: 142,834,075 probably null Het
Kif5a A G 10: 127,242,004 V407A probably benign Het
Lrrc57 C A 2: 120,607,891 D134Y probably damaging Het
Map1a A G 2: 121,305,176 T2158A probably benign Het
Mink1 A G 11: 70,612,282 N1068S possibly damaging Het
Mmp8 A T 9: 7,564,977 I295F probably damaging Het
Myo1h G T 5: 114,336,311 probably null Het
Nap1l5 C T 6: 58,906,520 G52S probably damaging Het
Npr3 A G 15: 11,883,362 F327S probably damaging Het
Nrxn2 C A 19: 6,532,053 Q1673K possibly damaging Het
Olfr457 T A 6: 42,472,166 D4V probably benign Het
Olfr53 G T 7: 140,652,901 L307F probably benign Het
Paf1 T C 7: 28,396,647 Y260H probably damaging Het
Pcmtd2 T C 2: 181,854,983 I251T probably damaging Het
Pde9a C T 17: 31,459,967 Q261* probably null Het
Ppip5k1 T C 2: 121,347,330 D332G probably damaging Het
Ppp1r36 A G 12: 76,428,149 probably null Het
Pprc1 T C 19: 46,061,449 L67P unknown Het
Prkdc T G 16: 15,708,903 L1346R probably damaging Het
Prl7c1 A T 13: 27,778,087 M79K possibly damaging Het
Ptprb C T 10: 116,369,457 probably null Het
R3hdm1 T A 1: 128,168,966 probably null Het
Ralgapa1 A G 12: 55,697,878 V1276A probably benign Het
Rapsn T C 2: 91,044,955 L361P probably benign Het
Rbm22 G T 18: 60,569,433 A275S probably benign Het
Rsph3a A G 17: 7,946,108 Y100C probably damaging Het
Rsrp1 A T 4: 134,923,963 M13L unknown Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Setd7 C A 3: 51,536,656 probably null Het
Slc38a2 A G 15: 96,693,585 I206T probably damaging Het
Slc9a8 T C 2: 167,465,358 F321L probably benign Het
Sppl2c A G 11: 104,187,130 D252G possibly damaging Het
Syne2 A G 12: 76,035,623 T117A probably damaging Het
Szt2 A T 4: 118,402,913 F79I possibly damaging Het
Tlr3 T A 8: 45,397,053 K860* probably null Het
Ttn T C 2: 76,794,674 S15187G probably benign Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Unc5c A T 3: 141,771,161 T363S possibly damaging Het
Usp40 G A 1: 87,978,479 T678I possibly damaging Het
Vmn1r62 A T 7: 5,675,610 T97S probably damaging Het
Vmn1r85 T A 7: 13,084,521 H232L probably benign Het
Vmn2r67 A G 7: 85,136,712 I695T probably damaging Het
Zfp383 C A 7: 29,912,201 D35E probably damaging Het
Zfp65 A T 13: 67,729,055 probably null Het
Zfp692 A G 11: 58,314,236 K437R probably damaging Het
Zfp831 A T 2: 174,647,128 T1199S possibly damaging Het
Zfr T A 15: 12,146,377 I338N probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGACACTTGCACACGTTC -3'
(R):5'- AGACTTGGGTCCTCATGGTG -3'

Sequencing Primer
(F):5'- GACACTTGCACACGTTCCATGTC -3'
(R):5'- CTCATGGTGGGATGGGGAC -3'
Posted On2019-12-27