Incidental Mutation 'R7979:Fam184a'
ID614867
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7979 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 53633706 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 126 (E126*)
Ref Sequence ENSEMBL: ENSMUSP00000151765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000075540] [ENSMUST00000163761] [ENSMUST00000164393] [ENSMUST00000169866] [ENSMUST00000171807] [ENSMUST00000217939] [ENSMUST00000218659] [ENSMUST00000218682] [ENSMUST00000219838]
Predicted Effect probably damaging
Transcript: ENSMUST00000020003
AA Change: Q1120H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: Q1120H

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075540
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163761
AA Change: Q980H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: Q980H

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164393
AA Change: Q46H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000165986
SMART Domains Protein: ENSMUSP00000128132
Gene: ENSMUSG00000019856

DomainStartEndE-ValueType
coiled coil region 9 40 N/A INTRINSIC
coiled coil region 102 166 N/A INTRINSIC
coiled coil region 212 235 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169866
AA Change: R142I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128426
Gene: ENSMUSG00000019856
AA Change: R142I

DomainStartEndE-ValueType
coiled coil region 18 41 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171807
AA Change: Q667H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856
AA Change: Q667H

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217939
AA Change: E126*
Predicted Effect probably benign
Transcript: ENSMUST00000218549
Predicted Effect probably benign
Transcript: ENSMUST00000218659
Predicted Effect probably benign
Transcript: ENSMUST00000218682
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000219838
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,004,958 T894A probably damaging Het
Abcc10 T A 17: 46,324,309 H256L probably benign Het
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Actn2 G A 13: 12,294,317 A290V possibly damaging Het
Actrt2 A T 4: 154,667,195 D161E probably benign Het
Adam19 T A 11: 46,137,543 C668S probably damaging Het
Alg8 T C 7: 97,390,916 L435S probably damaging Het
Amz2 G A 11: 109,436,587 E322K possibly damaging Het
Ankrd12 T A 17: 65,985,685 R918* probably null Het
Atp5f1 A G 3: 105,955,943 I59T probably damaging Het
Bach1 T A 16: 87,719,005 C145S possibly damaging Het
Bcl6b G T 11: 70,227,022 S309* probably null Het
Birc6 G T 17: 74,622,082 R2323L probably damaging Het
Catspere2 A T 1: 178,111,174 M538L probably benign Het
Ccdc154 A T 17: 25,171,826 M647L probably benign Het
Cdc14a T C 3: 116,294,833 T447A probably benign Het
Chst9 C T 18: 15,452,789 R239H probably damaging Het
Cs C T 10: 128,353,135 A171V probably damaging Het
D3Ertd751e T A 3: 41,756,073 F107I probably benign Het
D430041D05Rik T C 2: 104,258,040 D197G probably benign Het
Dcdc2c G A 12: 28,470,620 Q486* probably null Het
Dolk A T 2: 30,285,949 V28E possibly damaging Het
Dpf2 C T 19: 5,904,305 S191N probably benign Het
Eml3 T A 19: 8,933,807 F267I possibly damaging Het
Fam189a1 T C 7: 64,776,809 H232R probably damaging Het
Foxo3 T C 10: 42,197,736 S262G possibly damaging Het
Gm1527 T G 3: 28,921,593 probably null Het
Gm49380 G A 9: 44,112,799 L51F probably damaging Het
Gm9195 A T 14: 72,455,738 H1582Q unknown Het
Gm9573 G A 17: 35,620,025 P1090S unknown Het
Grip1 A G 10: 119,978,545 Q327R possibly damaging Het
Gstt1 A G 10: 75,784,142 F207S probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kif16b A G 2: 142,834,075 probably null Het
Kif5a A G 10: 127,242,004 V407A probably benign Het
Lrrc57 C A 2: 120,607,891 D134Y probably damaging Het
Map1a A G 2: 121,305,176 T2158A probably benign Het
Mink1 A G 11: 70,612,282 N1068S possibly damaging Het
Mmp8 A T 9: 7,564,977 I295F probably damaging Het
Myo1h G T 5: 114,336,311 probably null Het
Nap1l5 C T 6: 58,906,520 G52S probably damaging Het
Npr3 A G 15: 11,883,362 F327S probably damaging Het
Nrxn2 C A 19: 6,532,053 Q1673K possibly damaging Het
Olfr457 T A 6: 42,472,166 D4V probably benign Het
Olfr53 G T 7: 140,652,901 L307F probably benign Het
Paf1 T C 7: 28,396,647 Y260H probably damaging Het
Pcmtd2 T C 2: 181,854,983 I251T probably damaging Het
Pde9a C T 17: 31,459,967 Q261* probably null Het
Ppip5k1 T C 2: 121,347,330 D332G probably damaging Het
Ppp1r36 A G 12: 76,428,149 probably null Het
Pprc1 T C 19: 46,061,449 L67P unknown Het
Prkdc T G 16: 15,708,903 L1346R probably damaging Het
Prl7c1 A T 13: 27,778,087 M79K possibly damaging Het
Ptprb C T 10: 116,369,457 probably null Het
R3hdm1 T A 1: 128,168,966 probably null Het
Ralgapa1 A G 12: 55,697,878 V1276A probably benign Het
Rapsn T C 2: 91,044,955 L361P probably benign Het
Rbm22 G T 18: 60,569,433 A275S probably benign Het
Rsph3a A G 17: 7,946,108 Y100C probably damaging Het
Rsrp1 A T 4: 134,923,963 M13L unknown Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Setd7 C A 3: 51,536,656 probably null Het
Slc38a2 A G 15: 96,693,585 I206T probably damaging Het
Slc9a8 T C 2: 167,465,358 F321L probably benign Het
Sppl2c A G 11: 104,187,130 D252G possibly damaging Het
Syne2 A G 12: 76,035,623 T117A probably damaging Het
Szt2 A T 4: 118,402,913 F79I possibly damaging Het
Tlr3 T A 8: 45,397,053 K860* probably null Het
Ttn T C 2: 76,794,674 S15187G probably benign Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Unc5c A T 3: 141,771,161 T363S possibly damaging Het
Usp40 G A 1: 87,978,479 T678I possibly damaging Het
Vmn1r62 A T 7: 5,675,610 T97S probably damaging Het
Vmn1r85 T A 7: 13,084,521 H232L probably benign Het
Vmn2r67 A G 7: 85,136,712 I695T probably damaging Het
Zfp383 C A 7: 29,912,201 D35E probably damaging Het
Zfp65 A T 13: 67,729,055 probably null Het
Zfp692 A G 11: 58,314,236 K437R probably damaging Het
Zfp831 A T 2: 174,647,128 T1199S possibly damaging Het
Zfr T A 15: 12,146,377 I338N probably damaging Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7980:Fam184a UTSW 10 53633706 nonsense probably null
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATCGGAGAGACAAACACTTTCTC -3'
(R):5'- TCTGTCACAGAGTTCATGTGAGC -3'

Sequencing Primer
(F):5'- GACAAACACTTTCTCATTCACAGTG -3'
(R):5'- AGAGTTCATGTGAGCTGCCAC -3'
Posted On2019-12-27