Incidental Mutation 'R0671:Wdr90'
ID61490
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission 038856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0671 (G1)
Quality Score130
Status Validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25846393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1630 (T1630A)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079461
AA Change: T1630A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: T1630A

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176583
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176604
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176923
AA Change: T1612A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: T1612A

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 probably benign Het
4930430A15Rik A C 2: 111,204,137 V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 T31I probably benign Het
Abca17 A G 17: 24,281,249 F1323L probably benign Het
Abcf3 T A 16: 20,550,487 N206K probably damaging Het
Adam10 A G 9: 70,765,941 probably benign Het
Adamtsl3 A T 7: 82,523,182 Q451L probably damaging Het
Adgrl3 T A 5: 81,560,905 I413N probably benign Het
Asb18 G T 1: 89,993,171 A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 E2235G probably damaging Het
Blnk G T 19: 40,937,667 S330* probably null Het
Bpnt1 T G 1: 185,356,611 N319K probably benign Het
Brip1 G A 11: 86,152,667 T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 D288E probably benign Het
Calcoco2 A G 11: 96,107,528 V23A probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 probably benign Het
Cdk12 T C 11: 98,230,109 probably benign Het
Clec4a3 A G 6: 122,954,034 probably null Het
Cpne2 T A 8: 94,548,342 probably benign Het
Cyfip1 T C 7: 55,923,962 probably null Het
Cyp26c1 A G 19: 37,686,561 H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Defb43 T A 14: 63,011,838 V10D probably damaging Het
Dhx36 G A 3: 62,493,741 S368L possibly damaging Het
Dock6 G A 9: 21,804,627 probably benign Het
Elp2 T C 18: 24,612,442 probably benign Het
Emilin3 A G 2: 160,908,329 L453P probably damaging Het
Eml6 A T 11: 29,805,065 D903E probably benign Het
Ep300 T C 15: 81,616,134 probably benign Het
Ep400 G A 5: 110,688,196 T1899M unknown Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fbxo42 G A 4: 141,195,239 V239M probably damaging Het
Fermt2 T C 14: 45,469,319 D340G probably benign Het
Filip1 A T 9: 79,819,390 V649E probably damaging Het
Fut8 G A 12: 77,475,017 E477K probably damaging Het
Gbp3 G A 3: 142,565,390 G185D probably benign Het
Gclc G T 9: 77,786,798 D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 D43G possibly damaging Het
Gm960 A G 19: 4,626,188 S639P probably damaging Het
Gnptab A G 10: 88,443,304 probably benign Het
Greb1l C T 18: 10,474,303 T206I probably damaging Het
Grk4 A G 5: 34,748,267 N452S probably benign Het
Hcn2 G C 10: 79,734,232 probably null Het
Hpn T C 7: 31,109,160 K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 D3268G probably damaging Het
Immt A T 6: 71,871,557 Q467L possibly damaging Het
Kalrn T C 16: 34,116,408 S1636G probably benign Het
Kcnh8 T A 17: 52,978,113 L1037* probably null Het
Klhl33 T C 14: 50,892,394 T548A probably damaging Het
Klri2 T C 6: 129,740,208 I71V probably benign Het
Kmt2c A T 5: 25,404,365 C254S probably damaging Het
Lama3 T C 18: 12,477,590 I1170T possibly damaging Het
Med12l A G 3: 59,264,929 Q1702R probably damaging Het
Mga A T 2: 119,919,910 probably null Het
Mis18a A T 16: 90,720,673 I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 D83G probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 probably benign Het
Mrrf C T 2: 36,153,698 A149V probably benign Het
Mycbp2 A T 14: 103,194,588 M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 Q2387R probably benign Het
N4bp2 T C 5: 65,807,437 I943T probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 probably null Het
Ncor2 C T 5: 125,049,387 A136T probably benign Het
Olfr311 T A 11: 58,841,855 I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 Y282* probably null Het
Olfr539 A G 7: 140,667,677 D123G probably damaging Het
Olfr887 T A 9: 38,085,127 M97K possibly damaging Het
Opa1 T C 16: 29,602,207 probably benign Het
Pcdhb4 T C 18: 37,307,742 M35T probably benign Het
Per3 T C 4: 151,028,831 I347V probably benign Het
Pex13 G A 11: 23,665,831 P5L possibly damaging Het
Phkb T A 8: 85,875,693 W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 D247E probably benign Het
Plxnb2 A G 15: 89,157,981 S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 N196H possibly damaging Het
Rab27a G T 9: 73,075,433 D7Y probably damaging Het
Rars2 T A 4: 34,630,505 C82* probably null Het
Rccd1 A T 7: 80,320,217 probably benign Het
Riiad1 T C 3: 94,472,239 I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 E77G probably damaging Het
Rnf126 A T 10: 79,761,607 I157N possibly damaging Het
Rnf207 T C 4: 152,307,468 R623G probably benign Het
Rpusd1 T G 17: 25,728,524 F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 probably null Het
Scfd1 A T 12: 51,412,628 Q324L probably benign Het
Skint3 G T 4: 112,255,777 E195* probably null Het
Slc7a10 A T 7: 35,197,333 T165S probably benign Het
Smagp A G 15: 100,621,852 I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 H172R probably damaging Het
Spast A G 17: 74,339,451 probably benign Het
Sspo G T 6: 48,490,391 probably benign Het
Ston2 C T 12: 91,740,466 probably null Het
Tas2r103 T G 6: 133,036,350 E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 probably benign Het
Telo2 G A 17: 25,113,165 P143L probably benign Het
Tgfbi A T 13: 56,638,726 Y674F probably null Het
Tha1 T A 11: 117,873,157 probably benign Het
Timp4 T A 6: 115,249,853 S110C probably damaging Het
Tlr6 T C 5: 64,954,592 K324R probably benign Het
Tnip3 A G 6: 65,597,363 E137G probably damaging Het
Trak1 T C 9: 121,448,955 probably null Het
Trim47 A G 11: 116,108,352 S233P probably benign Het
Tspoap1 A T 11: 87,762,809 E155V probably damaging Het
Tsta3 A G 15: 75,928,958 V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 V36D probably damaging Het
Wdr27 T C 17: 14,928,396 T112A probably benign Het
Zfp352 A G 4: 90,223,919 T99A probably benign Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
R8260:Wdr90 UTSW 17 25845167 missense probably damaging 1.00
R8315:Wdr90 UTSW 17 25845425 missense probably benign 0.21
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCCATTATGTGAGCCCAACCC -3'
(R):5'- GTGATCCAGTTTCAGGTGCTGAACC -3'

Sequencing Primer
(F):5'- CAACCTGGAAGTGTGGTGC -3'
(R):5'- CTGGGGCCATGCTGATT -3'
Posted On2013-07-30