Incidental Mutation 'R7980:Zscan2'
ID614928
Institutional Source Beutler Lab
Gene Symbol Zscan2
Ensembl Gene ENSMUSG00000038797
Gene Namezinc finger and SCAN domain containing 2
SynonymsZfp-29, Zfp29
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7980 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80860920-80876537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80875700 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 390 (Y390N)
Ref Sequence ENSEMBL: ENSMUSP00000042321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044115] [ENSMUST00000132163] [ENSMUST00000147125] [ENSMUST00000155128]
PDB Structure
Aart, a six finger zinc finger designed to recognize ANN triplets [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000044115
AA Change: Y390N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042321
Gene: ENSMUSG00000038797
AA Change: Y390N

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
ZnF_C2H2 222 244 3.49e-5 SMART
ZnF_C2H2 250 272 5.21e-4 SMART
ZnF_C2H2 278 300 1.72e-4 SMART
ZnF_C2H2 306 328 3.69e-4 SMART
ZnF_C2H2 334 356 9.88e-5 SMART
ZnF_C2H2 362 384 4.87e-4 SMART
ZnF_C2H2 390 412 2.43e-4 SMART
ZnF_C2H2 418 440 1.69e-3 SMART
ZnF_C2H2 446 468 2.4e-3 SMART
ZnF_C2H2 474 496 1.69e-3 SMART
ZnF_C2H2 502 524 3.21e-4 SMART
ZnF_C2H2 530 552 1.92e-2 SMART
ZnF_C2H2 558 580 4.24e-4 SMART
ZnF_C2H2 586 608 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132163
SMART Domains Protein: ENSMUSP00000118774
Gene: ENSMUSG00000038797

DomainStartEndE-ValueType
SCAN 64 144 5.98e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147125
AA Change: Y390N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121143
Gene: ENSMUSG00000038797
AA Change: Y390N

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
ZnF_C2H2 222 244 3.49e-5 SMART
ZnF_C2H2 250 272 5.21e-4 SMART
ZnF_C2H2 278 300 1.72e-4 SMART
ZnF_C2H2 306 328 3.69e-4 SMART
ZnF_C2H2 334 356 9.88e-5 SMART
ZnF_C2H2 362 384 4.87e-4 SMART
ZnF_C2H2 390 412 2.43e-4 SMART
ZnF_C2H2 418 440 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155128
SMART Domains Protein: ENSMUSP00000117886
Gene: ENSMUSG00000038797

DomainStartEndE-ValueType
SCAN 64 160 3.18e-21 SMART
low complexity region 164 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several copies of zinc finger motif, which is commonly found in transcriptional regulatory proteins. Studies in mice show that this gene is expressed during embryonic development, and specifically in the testis in adult mice, suggesting that it may play a role in regulating genes in germ cells. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap46 G A 7: 139,679,741 probably null Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Dock8 G T 19: 25,131,933 probably null Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Mup18 G T 4: 61,672,688 probably null Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde1b T C 15: 103,503,589 probably null Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Other mutations in Zscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Zscan2 APN 7 80875416 missense probably damaging 1.00
IGL01793:Zscan2 APN 7 80874944 missense probably null 0.79
R1570:Zscan2 UTSW 7 80863393 missense probably damaging 1.00
R1618:Zscan2 UTSW 7 80875786 nonsense probably null
R1622:Zscan2 UTSW 7 80875386 missense probably benign 0.01
R1842:Zscan2 UTSW 7 80875553 missense probably damaging 1.00
R3122:Zscan2 UTSW 7 80863344 missense probably benign 0.41
R3415:Zscan2 UTSW 7 80875402 missense probably damaging 1.00
R4674:Zscan2 UTSW 7 80875402 missense probably damaging 1.00
R5988:Zscan2 UTSW 7 80876199 missense possibly damaging 0.47
R6276:Zscan2 UTSW 7 80875809 missense probably benign
R6379:Zscan2 UTSW 7 80863337 missense probably benign 0.00
R7897:Zscan2 UTSW 7 80875700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAGCCGGAAATCCCACC -3'
(R):5'- TTGTACGGCTTCTCCACCAG -3'

Sequencing Primer
(F):5'- TGACGGCTCGAACTTTAGTAGACAC -3'
(R):5'- CTGAAGTTCTTGCCGCA -3'
Posted On2019-12-27