Mutagenetix > Incidental Mutation

Incidental Mutation 'R0671:Greb1l'

61493

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038856-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0671 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10474303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 206 (T206I)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: T206I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T206I

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172532
AA Change: T206I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T206I

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Meta Mutation Damage Score

0.1089

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

99% (125/126)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067K01Rik	T	C	8: 84,003,008		probably benign	Het
4930430A15Rik	A	C	2: 111,204,137	V350G	possibly damaging	Het
A530064D06Rik	G	A	17: 48,166,656	T31I	probably benign	Het
Abca17	A	G	17: 24,281,249	F1323L	probably benign	Het
Abcf3	T	A	16: 20,550,487	N206K	probably damaging	Het
Adam10	A	G	9: 70,765,941		probably benign	Het
Adamtsl3	A	T	7: 82,523,182	Q451L	probably damaging	Het
Adgrl3	T	A	5: 81,560,905	I413N	probably benign	Het
Asb18	G	T	1: 89,993,171	A128E	probably damaging	Het
Atf7ip2	T	C	16: 10,241,879	S428P	possibly damaging	Het
Atp8b5	G	T	4: 43,291,672	C15F	possibly damaging	Het
Bahcc1	A	G	11: 120,287,320	E2235G	probably damaging	Het
Blnk	G	T	19: 40,937,667	S330*	probably null	Het
Bpnt1	T	G	1: 185,356,611	N319K	probably benign	Het
Brip1	G	A	11: 86,152,667	T357I	possibly damaging	Het
Cadm1	T	A	9: 47,813,806	D288E	probably benign	Het
Calcoco2	A	G	11: 96,107,528	V23A	probably damaging	Het
Cand2	G	A	6: 115,803,805	E1217K	probably damaging	Het
Ccdc154	G	T	17: 25,167,285		probably benign	Het
Cdk12	T	C	11: 98,230,109		probably benign	Het
Clec4a3	A	G	6: 122,954,034		probably null	Het
Cpne2	T	A	8: 94,548,342		probably benign	Het
Cyfip1	T	C	7: 55,923,962		probably null	Het
Cyp26c1	A	G	19: 37,686,561	H110R	probably damaging	Het
Cyp2j13	A	G	4: 96,071,695	Y75H	probably damaging	Het
Defb43	T	A	14: 63,011,838	V10D	probably damaging	Het
Dhx36	G	A	3: 62,493,741	S368L	possibly damaging	Het
Dock6	G	A	9: 21,804,627		probably benign	Het
Elp2	T	C	18: 24,612,442		probably benign	Het
Emilin3	A	G	2: 160,908,329	L453P	probably damaging	Het
Eml6	A	T	11: 29,805,065	D903E	probably benign	Het
Ep300	T	C	15: 81,616,134		probably benign	Het
Ep400	G	A	5: 110,688,196	T1899M	unknown	Het
Fancg	A	G	4: 43,002,998	S620P	probably benign	Het
Fbxo42	G	A	4: 141,195,239	V239M	probably damaging	Het
Fermt2	T	C	14: 45,469,319	D340G	probably benign	Het
Filip1	A	T	9: 79,819,390	V649E	probably damaging	Het
Fut8	G	A	12: 77,475,017	E477K	probably damaging	Het
Gbp3	G	A	3: 142,565,390	G185D	probably benign	Het
Gclc	G	T	9: 77,786,798	D345Y	probably damaging	Het
Gkn2	A	G	6: 87,375,818	D43G	possibly damaging	Het
Gm960	A	G	19: 4,626,188	S639P	probably damaging	Het
Gnptab	A	G	10: 88,443,304		probably benign	Het
Grk4	A	G	5: 34,748,267	N452S	probably benign	Het
Hcn2	G	C	10: 79,734,232		probably null	Het
Hpn	T	C	7: 31,109,160	K76E	possibly damaging	Het
Hspg2	A	G	4: 137,553,280	D3268G	probably damaging	Het
Immt	A	T	6: 71,871,557	Q467L	possibly damaging	Het
Kalrn	T	C	16: 34,116,408	S1636G	probably benign	Het
Kcnh8	T	A	17: 52,978,113	L1037*	probably null	Het
Klhl33	T	C	14: 50,892,394	T548A	probably damaging	Het
Klri2	T	C	6: 129,740,208	I71V	probably benign	Het
Kmt2c	A	T	5: 25,404,365	C254S	probably damaging	Het
Lama3	T	C	18: 12,477,590	I1170T	possibly damaging	Het
Med12l	A	G	3: 59,264,929	Q1702R	probably damaging	Het
Mga	A	T	2: 119,919,910		probably null	Het
Mis18a	A	T	16: 90,720,673	I172K	possibly damaging	Het
Mrgpre	T	C	7: 143,781,517	D83G	probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mrpl39	T	C	16: 84,734,394		probably benign	Het
Mrrf	C	T	2: 36,153,698	A149V	probably benign	Het
Mycbp2	A	T	14: 103,194,588	M2338K	possibly damaging	Het
Myo18b	T	C	5: 112,692,766	Q2387R	probably benign	Het
N4bp2	T	C	5: 65,807,437	I943T	probably damaging	Het
Ncapd3	T	A	9: 27,087,477	N1254K	probably benign	Het
Ncoa1	A	T	12: 4,249,758		probably null	Het
Ncor2	C	T	5: 125,049,387	A136T	probably benign	Het
Olfr311	T	A	11: 58,841,855	I247N	possibly damaging	Het
Olfr483	C	A	7: 108,104,156	Y282*	probably null	Het
Olfr539	A	G	7: 140,667,677	D123G	probably damaging	Het
Olfr887	T	A	9: 38,085,127	M97K	possibly damaging	Het
Opa1	T	C	16: 29,602,207		probably benign	Het
Pcdhb4	T	C	18: 37,307,742	M35T	probably benign	Het
Per3	T	C	4: 151,028,831	I347V	probably benign	Het
Pex13	G	A	11: 23,665,831	P5L	possibly damaging	Het
Phkb	T	A	8: 85,875,693	W38R	probably damaging	Het
Plekhf1	A	T	7: 38,221,402	D247E	probably benign	Het
Plxnb2	A	G	15: 89,157,981	S1607P	probably benign	Het
Plxnc1	T	A	10: 94,799,332	H1344L	possibly damaging	Het
Ptk7	T	G	17: 46,590,312	N196H	possibly damaging	Het
Rab27a	G	T	9: 73,075,433	D7Y	probably damaging	Het
Rars2	T	A	4: 34,630,505	C82*	probably null	Het
Rccd1	A	T	7: 80,320,217		probably benign	Het
Riiad1	T	C	3: 94,472,239	I56V	possibly damaging	Het
Rnase4	A	G	14: 51,105,050	E77G	probably damaging	Het
Rnf126	A	T	10: 79,761,607	I157N	possibly damaging	Het
Rnf207	T	C	4: 152,307,468	R623G	probably benign	Het
Rpusd1	T	G	17: 25,728,524	F62V	possibly damaging	Het
Rxfp1	T	C	3: 79,663,293		probably null	Het
Scfd1	A	T	12: 51,412,628	Q324L	probably benign	Het
Skint3	G	T	4: 112,255,777	E195*	probably null	Het
Slc7a10	A	T	7: 35,197,333	T165S	probably benign	Het
Smagp	A	G	15: 100,621,852	I97T	probably damaging	Het
Sostdc1	A	G	12: 36,317,341	H172R	probably damaging	Het
Spast	A	G	17: 74,339,451		probably benign	Het
Sspo	G	T	6: 48,490,391		probably benign	Het
Ston2	C	T	12: 91,740,466		probably null	Het
Tas2r103	T	G	6: 133,036,350	E251A	probably benign	Het
Tbc1d2b	A	T	9: 90,222,505		probably benign	Het
Telo2	G	A	17: 25,113,165	P143L	probably benign	Het
Tgfbi	A	T	13: 56,638,726	Y674F	probably null	Het
Tha1	T	A	11: 117,873,157		probably benign	Het
Timp4	T	A	6: 115,249,853	S110C	probably damaging	Het
Tlr6	T	C	5: 64,954,592	K324R	probably benign	Het
Tnip3	A	G	6: 65,597,363	E137G	probably damaging	Het
Trak1	T	C	9: 121,448,955		probably null	Het
Trim47	A	G	11: 116,108,352	S233P	probably benign	Het
Tspoap1	A	T	11: 87,762,809	E155V	probably damaging	Het
Tsta3	A	G	15: 75,928,958	V27A	possibly damaging	Het
Uggt1	A	T	1: 36,155,128	L1343Q	probably damaging	Het
Utp14b	T	C	1: 78,664,735	S117P	probably benign	Het
Vmn1r124	A	T	7: 21,260,511	V36D	probably damaging	Het
Wdr27	T	C	17: 14,928,396	T112A	probably benign	Het
Wdr90	T	C	17: 25,846,393	T1630A	probably benign	Het
Zfp352	A	G	4: 90,223,919	T99A	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAAGACTCCGCTGAAAACCTAC -3'
(R):5'- TCTGGAGACAAGTCTGGAGACCTG -3'

Sequencing Primer
(F):5'- GGGATATTGTTGGCTCAATAGAC -3'
(R):5'- AAGTCTGGAGACCTGCACTTTC -3'

Posted On

2013-07-30