Incidental Mutation 'R0671:Pcdhb4'
ID 61495
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Name protocadherin beta 4
Synonyms PcdhbD, Pcdhb5A
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R0671 (G1)
Quality Score 105
Status Validated
Chromosome 18
Chromosomal Location 37440508-37444225 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37440795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 35 (M35T)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ6
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
AA Change: M35T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: M35T

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37,442,969 (GRCm39) missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37,441,566 (GRCm39) missense probably benign
IGL01325:Pcdhb4 APN 18 37,442,676 (GRCm39) missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37,441,803 (GRCm39) missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37,442,067 (GRCm39) missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37,442,057 (GRCm39) missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37,440,735 (GRCm39) missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37,442,721 (GRCm39) missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37,443,030 (GRCm39) missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37,441,569 (GRCm39) missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37,441,938 (GRCm39) missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37,442,268 (GRCm39) missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37,441,263 (GRCm39) missense probably damaging 1.00
R0738:Pcdhb4 UTSW 18 37,441,764 (GRCm39) missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37,442,938 (GRCm39) nonsense probably null
R0893:Pcdhb4 UTSW 18 37,442,423 (GRCm39) splice site probably null
R1932:Pcdhb4 UTSW 18 37,442,594 (GRCm39) missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37,441,921 (GRCm39) missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37,441,788 (GRCm39) missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37,441,979 (GRCm39) missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37,442,367 (GRCm39) missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37,441,901 (GRCm39) missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37,443,017 (GRCm39) missense probably benign
R4606:Pcdhb4 UTSW 18 37,441,705 (GRCm39) missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37,441,553 (GRCm39) missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37,441,452 (GRCm39) missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37,442,979 (GRCm39) missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37,440,819 (GRCm39) missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37,442,034 (GRCm39) missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37,442,042 (GRCm39) missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37,442,619 (GRCm39) missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37,441,482 (GRCm39) missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37,441,074 (GRCm39) missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37,442,625 (GRCm39) missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37,441,835 (GRCm39) missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37,442,292 (GRCm39) missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37,441,222 (GRCm39) missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37,442,328 (GRCm39) missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37,442,505 (GRCm39) missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37,442,602 (GRCm39) missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37,442,667 (GRCm39) missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37,442,293 (GRCm39) missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37,442,349 (GRCm39) missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37,441,717 (GRCm39) missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37,442,453 (GRCm39) missense probably damaging 0.99
R8697:Pcdhb4 UTSW 18 37,441,832 (GRCm39) missense probably benign 0.15
R8815:Pcdhb4 UTSW 18 37,442,055 (GRCm39) missense probably damaging 1.00
R9008:Pcdhb4 UTSW 18 37,440,714 (GRCm39) missense probably benign
R9225:Pcdhb4 UTSW 18 37,441,695 (GRCm39) missense possibly damaging 0.68
R9278:Pcdhb4 UTSW 18 37,441,925 (GRCm39) missense possibly damaging 0.61
R9299:Pcdhb4 UTSW 18 37,442,264 (GRCm39) missense probably benign 0.02
R9390:Pcdhb4 UTSW 18 37,442,781 (GRCm39) missense possibly damaging 0.80
R9582:Pcdhb4 UTSW 18 37,441,417 (GRCm39) missense probably damaging 1.00
R9686:Pcdhb4 UTSW 18 37,442,943 (GRCm39) missense probably damaging 0.98
R9721:Pcdhb4 UTSW 18 37,442,905 (GRCm39) missense possibly damaging 0.70
Z1177:Pcdhb4 UTSW 18 37,442,966 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTGATGCCCTGGAAGCCATTAC -3'
(R):5'- CTGAGCTGCCTTCAGAGGAAACAC -3'

Sequencing Primer
(F):5'- TGGAAGCCATTACCGAATCAG -3'
(R):5'- AGAACTGCACAGGGTTTTTCAG -3'
Posted On 2013-07-30