Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R7980:Ahr'
ID614950
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Namearyl-hydrocarbon receptor
SynonymsbHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
Accession Numbers

Genbank: NM_013464; MGI: 105043

  
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7980 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location35497974-35535038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35504170 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 650 (N650S)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116436
AA Change: N650S

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: N650S

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap46 G A 7: 139,679,741 probably null Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Dock8 G T 19: 25,131,933 probably null Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Mup18 G T 4: 61,672,688 probably null Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde1b T C 15: 103,503,589 probably null Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R0784:Ahr UTSW 12 35508142 missense possibly damaging 0.79
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGATTACAGGGAGCAAAGTTCTG -3'
(R):5'- AAATCCTGACCTACGTGCAGG -3'

Sequencing Primer
(F):5'- AGCAAAGTTCTGTGTGTAAGGC -3'
(R):5'- TGACCTACGTGCAGGATTCC -3'
Posted On2019-12-27