Incidental Mutation 'R7981:4931409K22Rik'
ID614986
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7981 (G1)
Quality Score117.008
Status Not validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24553645 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 117 (E117G)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000198887] [ENSMUST00000200634]
Predicted Effect probably damaging
Transcript: ENSMUST00000088302
AA Change: E117G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: E117G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198887
SMART Domains Protein: ENSMUSP00000142918
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200634
AA Change: E117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199
AA Change: E117G

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,364,449 probably null Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
BC017158 C A 7: 128,298,005 A27S probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Isl2 C A 9: 55,542,439 S97R probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tnpo3 T C 6: 29,565,224 I577V probably benign Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Zzef1 T G 11: 72,796,547 L84R probably damaging Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
R7480:4931409K22Rik UTSW 5 24546906 missense probably damaging 1.00
R7693:4931409K22Rik UTSW 5 24546628 missense probably benign 0.01
R7782:4931409K22Rik UTSW 5 24544226 missense probably damaging 0.98
R7814:4931409K22Rik UTSW 5 24545422 missense possibly damaging 0.95
R7898:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R8024:4931409K22Rik UTSW 5 24550636 missense possibly damaging 0.70
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Z1177:4931409K22Rik UTSW 5 24550795 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGAGTGTCCCCAGTTACAG -3'
(R):5'- TGACTCTTGGGTCCTAAGCC -3'

Sequencing Primer
(F):5'- GCTTAGAGTTGAACCACTGTCAGAC -3'
(R):5'- GGGTCCTAAGCCAGAATTCAC -3'
Posted On2019-12-27