Incidental Mutation 'R7981:Tnpo3'
ID614994
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7981 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29565224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 577 (I577V)
Ref Sequence ENSEMBL: ENSMUSP00000012679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect probably benign
Transcript: ENSMUST00000012679
AA Change: I577V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: I577V

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115251
AA Change: I577V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: I577V

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,553,645 E117G probably damaging Het
Acaca T C 11: 84,364,449 probably null Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
BC017158 C A 7: 128,298,005 A27S probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Isl2 C A 9: 55,542,439 S97R probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Zzef1 T G 11: 72,796,547 L84R probably damaging Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R7984:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAACATTCCCCTGCCTG -3'
(R):5'- GATTTGGAGTAGAGGCAACACAGTC -3'

Sequencing Primer
(F):5'- GCCTGTTTCCTACTATGTGAATAC -3'
(R):5'- ACATACTCATGTTTGCTGCTAAG -3'
Posted On2019-12-27