Incidental Mutation 'R7981:Isl2'
ID615005
Institutional Source Beutler Lab
Gene Symbol Isl2
Ensembl Gene ENSMUSG00000032318
Gene Nameinsulin related protein 2 (islet 2)
Synonyms3110001N10Rik, islet-2, islet 2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7981 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location55538672-55546180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55542439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 97 (S97R)
Ref Sequence ENSEMBL: ENSMUSP00000034869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034869] [ENSMUST00000114290] [ENSMUST00000164373] [ENSMUST00000175950]
PDB Structure
The structural basis for partial redundancy in a class of transcription factors, the lim-homeodomain proteins, in neural cell type specification [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034869
AA Change: S97R

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034869
Gene: ENSMUSG00000032318
AA Change: S97R

DomainStartEndE-ValueType
LIM 26 80 4.09e-11 SMART
LIM 88 142 2.67e-15 SMART
HOX 191 253 3.41e-20 SMART
low complexity region 323 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114290
SMART Domains Protein: ENSMUSP00000109929
Gene: ENSMUSG00000032318

DomainStartEndE-ValueType
LIM 26 80 4.09e-11 SMART
low complexity region 123 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164373
SMART Domains Protein: ENSMUSP00000130638
Gene: ENSMUSG00000032318

DomainStartEndE-ValueType
LIM 26 80 4.09e-11 SMART
low complexity region 123 141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175950
AA Change: S108R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139485
Gene: ENSMUSG00000032318
AA Change: S108R

DomainStartEndE-ValueType
LIM 37 91 4.09e-11 SMART
LIM 99 152 1.53e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene result in neonatal lethality, motor neuron migration defects and impaired visceral motor neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,553,645 E117G probably damaging Het
Acaca T C 11: 84,364,449 probably null Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
BC017158 C A 7: 128,298,005 A27S probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tnpo3 T C 6: 29,565,224 I577V probably benign Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Zzef1 T G 11: 72,796,547 L84R probably damaging Het
Other mutations in Isl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Isl2 APN 9 55544969 missense possibly damaging 0.90
IGL01123:Isl2 APN 9 55545462 missense probably damaging 1.00
IGL01773:Isl2 APN 9 55544220 missense probably damaging 1.00
IGL02801:Isl2 APN 9 55545532 unclassified probably null
R0578:Isl2 UTSW 9 55545035 missense probably damaging 0.99
R3737:Isl2 UTSW 9 55542470 missense probably benign 0.17
R4035:Isl2 UTSW 9 55542470 missense probably benign 0.17
R4750:Isl2 UTSW 9 55544312 missense probably benign 0.21
R4851:Isl2 UTSW 9 55544987 missense possibly damaging 0.64
R5107:Isl2 UTSW 9 55542286 missense probably benign 0.17
R5181:Isl2 UTSW 9 55542277 missense probably benign 0.33
R6724:Isl2 UTSW 9 55541288 missense possibly damaging 0.92
R7235:Isl2 UTSW 9 55544171 missense probably benign
R7418:Isl2 UTSW 9 55544352 missense probably benign 0.00
R7457:Isl2 UTSW 9 55544956 missense probably benign 0.03
R7632:Isl2 UTSW 9 55541156 utr 5 prime probably null
R7705:Isl2 UTSW 9 55542401 missense probably benign 0.03
R7898:Isl2 UTSW 9 55542439 missense probably benign 0.18
X0067:Isl2 UTSW 9 55542271 missense probably damaging 1.00
Z1176:Isl2 UTSW 9 55542215 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGAAAACCTACTGCAAGCG -3'
(R):5'- TCGTACATCCTACTGACGCG -3'

Sequencing Primer
(F):5'- TACTGCAAGCGGGACTACGTC -3'
(R):5'- TTACCTGGCAGATGCAGGC -3'
Posted On2019-12-27