Incidental Mutation 'R7982:Dnttip2'
ID615049
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms4930588M11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location122274388-122285271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122282369 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 650 (M650K)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035776]
Predicted Effect probably damaging
Transcript: ENSMUST00000035776
AA Change: M650K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: M650K

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,809,320 T49A possibly damaging Het
4932415D10Rik A G 10: 82,282,897 S4760P unknown Het
Aagab T C 9: 63,616,850 F80L probably benign Het
Aox2 A G 1: 58,281,237 probably null Het
Arhgef2 T C 3: 88,621,262 S2P probably damaging Het
Bcar3 T G 3: 122,508,253 V199G probably damaging Het
Cacna1a G A 8: 84,594,173 V1587M possibly damaging Het
Caps2 C A 10: 112,165,761 S19Y possibly damaging Het
Cobll1 A G 2: 65,125,931 C328R probably damaging Het
Colec11 A C 12: 28,595,282 V130G probably damaging Het
Dennd5b A T 6: 149,041,661 D572E probably damaging Het
Dido1 A T 2: 180,671,597 S961T possibly damaging Het
Dnah7c A T 1: 46,514,701 M380L probably benign Het
Dnaic2 T C 11: 114,738,630 I161T probably benign Het
Dpp6 C T 5: 27,721,079 P717L probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha10 A G 4: 124,914,835 E759G Het
Frmd4a T C 2: 4,604,089 W923R probably damaging Het
Ftsj3 C A 11: 106,252,289 E400* probably null Het
Gfm1 T A 3: 67,473,527 N658K probably benign Het
Gm21560 A T 14: 6,218,220 I86N probably damaging Het
Gm6657 A G 12: 78,197,422 N50D Het
Gpr68 C A 12: 100,878,448 C279F probably damaging Het
Hspg2 G A 4: 137,548,116 A2752T possibly damaging Het
Hydin A T 8: 110,587,748 D4288V probably benign Het
Ift74 A G 4: 94,621,977 T82A possibly damaging Het
Ints7 T A 1: 191,621,315 W918R probably damaging Het
Kcnc1 T A 7: 46,427,821 I349N probably damaging Het
Loxl1 C T 9: 58,290,834 D580N probably damaging Het
Mlph A T 1: 90,941,763 R496* probably null Het
Mtdh A G 15: 34,123,719 D364G possibly damaging Het
Mtmr11 C A 3: 96,170,428 L580I probably damaging Het
Muc16 T C 9: 18,640,697 I4767V probably benign Het
Myot A G 18: 44,354,184 T363A probably benign Het
Nfxl1 G A 5: 72,524,215 P658S probably damaging Het
Nhlrc3 A C 3: 53,461,659 S120A probably benign Het
Nmur2 C A 11: 56,040,335 Q183H probably benign Het
Nucb2 T A 7: 116,521,970 I45K probably benign Het
Nup155 A T 15: 8,119,179 D277V probably damaging Het
Olfr995 T C 2: 85,438,397 T254A probably benign Het
Orc1 T G 4: 108,603,371 probably null Het
Panx2 A G 15: 89,068,733 T468A possibly damaging Het
Pcdh7 A G 5: 57,719,810 S236G probably benign Het
Pcdhga2 G C 18: 37,670,857 G585R probably damaging Het
Pgr T G 9: 8,903,742 M588R probably benign Het
Ptpn18 A T 1: 34,469,905 probably null Het
Rbm8a2 T A 1: 175,978,641 H90L probably benign Het
Ryr3 A T 2: 112,646,950 L4507Q possibly damaging Het
Serpina12 A G 12: 104,038,265 V36A probably benign Het
Sis T A 3: 72,937,251 S717C probably damaging Het
Slit2 A G 5: 48,247,185 E846G possibly damaging Het
Smr3a C T 5: 88,008,227 H85Y unknown Het
Sned1 G C 1: 93,274,082 R590P probably benign Het
Sult2a7 A G 7: 14,465,209 Y298H probably damaging Het
Syn3 A G 10: 86,064,929 V365A possibly damaging Het
Syne1 A T 10: 5,227,956 Y4839* probably null Het
Tbl3 G T 17: 24,702,484 H478N probably damaging Het
Tcirg1 A T 19: 3,899,104 I395N probably damaging Het
Ticrr T C 7: 79,669,485 I406T probably benign Het
Tmem120a C A 5: 135,737,198 K123N probably benign Het
Tmem173 A G 18: 35,734,573 S357P probably damaging Het
Tmem184c A G 8: 77,597,811 V350A probably damaging Het
Tmem70 G T 1: 16,677,044 M128I probably benign Het
Tmx3 A T 18: 90,527,874 probably null Het
Topors G C 4: 40,260,356 S976W unknown Het
Trp53 T C 11: 69,590,693 L341P probably damaging Het
Usp14 T C 18: 10,000,563 K366E possibly damaging Het
Zbtb49 G T 5: 38,213,930 C202* probably null Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122284499 missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122275290 missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122278737 splice site probably benign
IGL01341:Dnttip2 APN 3 122276612 missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122282474 missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122276295 missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122284413 missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122276261 missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122282438 missense probably damaging 1.00
Abyss UTSW 3 122276221 missense probably damaging 0.99
Chasm UTSW 3 122275808 missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122275462 missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122276161 missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122276422 missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122276748 missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122276149 missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122280744 missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122276221 missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122276537 missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122275391 missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122280761 missense probably damaging 1.00
R4367:Dnttip2 UTSW 3 122276497 missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122285101 missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122276592 missense probably damaging 1.00
R5082:Dnttip2 UTSW 3 122275941 missense probably damaging 0.98
R5436:Dnttip2 UTSW 3 122278769 missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122276797 missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122275568 missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122285168 utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122278862 missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122275256 missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122284400 missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122275523 missense possibly damaging 0.67
R6519:Dnttip2 UTSW 3 122275471 missense probably benign 0.05
R6670:Dnttip2 UTSW 3 122276221 missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122276803 missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122275808 missense probably damaging 1.00
R6969:Dnttip2 UTSW 3 122282492 missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122276532 nonsense probably null
R7233:Dnttip2 UTSW 3 122276390 missense probably benign 0.26
R7423:Dnttip2 UTSW 3 122275526 missense probably benign
R7591:Dnttip2 UTSW 3 122276468 nonsense probably null
R7765:Dnttip2 UTSW 3 122275945 missense probably benign 0.09
R7842:Dnttip2 UTSW 3 122276341 missense probably benign 0.03
R7899:Dnttip2 UTSW 3 122282369 missense probably damaging 1.00
R7925:Dnttip2 UTSW 3 122276341 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTATAACCCAGCAGGCAGTG -3'
(R):5'- TAAGCTGCTCTCCACAGAAC -3'

Sequencing Primer
(F):5'- TCTCACAGAGGGTCAGCTTG -3'
(R):5'- TAAGCTGCTCTCCACAGAACATAAC -3'
Posted On2019-12-27