Incidental Mutation 'R0673:Otop1'
ID61510
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Nameotopetrin 1
Synonymstlt, A530025J20Rik
MMRRC Submission 038858-MU
Accession Numbers

NCBI RefSeq: NM_172709.3; MGI:2388363

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0673 (G1)
Quality Score92
Status Not validated
Chromosome5
Chromosomal Location38275972-38304217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38287948 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 150 (V150A)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063136
AA Change: V147A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: V147A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114099
AA Change: V150A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: V150A

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 4881519; 2655558; 1856638; 4950042
PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38302845 missense probably damaging 1.00
IGL01793:Otop1 APN 5 38299871 missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38287983 missense probably damaging 1.00
IGL02111:Otop1 APN 5 38277701 missense probably benign 0.01
IGL02660:Otop1 APN 5 38288005 missense probably damaging 0.99
IGL02672:Otop1 APN 5 38277826 critical splice donor site probably null
IGL03164:Otop1 APN 5 38287962 nonsense probably null
P0015:Otop1 UTSW 5 38294559 splice site probably benign
R0092:Otop1 UTSW 5 38299830 missense probably damaging 0.97
R0639:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R2092:Otop1 UTSW 5 38299766 missense probably damaging 1.00
R2105:Otop1 UTSW 5 38300458 missense probably benign
R2152:Otop1 UTSW 5 38302851 missense probably damaging 1.00
R3971:Otop1 UTSW 5 38300189 missense probably benign 0.04
R3972:Otop1 UTSW 5 38300189 missense probably benign 0.04
R4575:Otop1 UTSW 5 38299721 missense probably damaging 1.00
R4660:Otop1 UTSW 5 38300024 missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38294548 critical splice donor site probably null
R5412:Otop1 UTSW 5 38297984 missense probably benign 0.25
R5461:Otop1 UTSW 5 38299715 missense probably damaging 1.00
R5607:Otop1 UTSW 5 38294504 missense possibly damaging 0.68
R5625:Otop1 UTSW 5 38302761 missense probably damaging 1.00
R5677:Otop1 UTSW 5 38300163 missense probably damaging 1.00
R5792:Otop1 UTSW 5 38297916 missense probably benign 0.04
R5878:Otop1 UTSW 5 38277822 missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38287890 splice site probably null
R7338:Otop1 UTSW 5 38300203 nonsense probably null
X0064:Otop1 UTSW 5 38299751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTGCATTTCTCACTGTTTGGTCT -3'
(R):5'- CAGCTCATTATTCCTGACAAGAGCCAC -3'

Sequencing Primer
(F):5'- AACACACATGTGTCTCTCCC -3'
(R):5'- GATGCGAGCTAAATCTGACTCC -3'
Posted On2013-07-30