Incidental Mutation 'R7984:Ppip5k1'
ID615154
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Namediphosphoinositol pentakisphosphate kinase 1
SynonymsHisppd2a, B430315C20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121310561-121355396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121311909 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1353 (Q1353R)
Ref Sequence ENSEMBL: ENSMUSP00000057632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
Predicted Effect probably damaging
Transcript: ENSMUST00000052029
AA Change: Q1353R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: Q1353R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094639
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110625
AA Change: Q1332R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: Q1332R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110626
AA Change: Q1353R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: Q1353R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110627
AA Change: Q1332R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: Q1332R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110628
AA Change: Q1333R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: Q1333R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110639
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121347358 missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121343179 missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121343210 nonsense probably null
IGL01704:Ppip5k1 APN 2 121312074 missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121337860 missense probably benign
IGL02101:Ppip5k1 APN 2 121331608 missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121331553 splice site probably null
IGL02701:Ppip5k1 APN 2 121316649 splice site probably null
IGL03188:Ppip5k1 APN 2 121326846 unclassified probably benign
lapidus UTSW 2 121337463 missense probably benign 0.29
Roca UTSW 2 121336751 missense probably damaging 0.98
R0363:Ppip5k1 UTSW 2 121347355 missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121312005 missense probably benign 0.13
R1664:Ppip5k1 UTSW 2 121337182 missense probably benign 0.02
R1753:Ppip5k1 UTSW 2 121342631 missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121350586 missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121348547 missense probably damaging 1.00
R2033:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R2037:Ppip5k1 UTSW 2 121343193 missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121342871 unclassified probably benign
R2103:Ppip5k1 UTSW 2 121321653 unclassified probably null
R3414:Ppip5k1 UTSW 2 121327661 missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121343563 missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R4843:Ppip5k1 UTSW 2 121326887 missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121312390 missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121311720 missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121336772 missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121316676 missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121337899 missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121350491 nonsense probably null
R6076:Ppip5k1 UTSW 2 121337110 missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121337463 missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121323203 unclassified probably benign
R6555:Ppip5k1 UTSW 2 121337612 missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121311936 missense probably benign 0.00
R7075:Ppip5k1 UTSW 2 121321750 missense probably damaging 1.00
R7251:Ppip5k1 UTSW 2 121347571 missense probably benign 0.05
R7332:Ppip5k1 UTSW 2 121311969 missense probably damaging 0.96
R7359:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R7462:Ppip5k1 UTSW 2 121336751 missense probably damaging 0.98
R7568:Ppip5k1 UTSW 2 121337615 missense probably damaging 1.00
R7654:Ppip5k1 UTSW 2 121348559 missense probably damaging 1.00
R7678:Ppip5k1 UTSW 2 121337661 missense probably damaging 1.00
R7841:Ppip5k1 UTSW 2 121342795 missense probably benign 0.13
R7877:Ppip5k1 UTSW 2 121316754 missense probably benign 0.01
R7896:Ppip5k1 UTSW 2 121347330 missense probably damaging 1.00
R7901:Ppip5k1 UTSW 2 121311909 missense probably damaging 0.99
R7911:Ppip5k1 UTSW 2 121342658 missense possibly damaging 0.89
R7924:Ppip5k1 UTSW 2 121342795 missense probably benign 0.13
R7960:Ppip5k1 UTSW 2 121316754 missense probably benign 0.01
R7979:Ppip5k1 UTSW 2 121347330 missense probably damaging 1.00
R7992:Ppip5k1 UTSW 2 121342658 missense possibly damaging 0.89
R8167:Ppip5k1 UTSW 2 121342801 nonsense probably null
R8179:Ppip5k1 UTSW 2 121341614 critical splice donor site probably null
X0020:Ppip5k1 UTSW 2 121341655 missense probably damaging 0.99
Z1176:Ppip5k1 UTSW 2 121337866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCCTGATCAATCTCCTCAG -3'
(R):5'- GTTGCTGAAGGACCATGACAC -3'

Sequencing Primer
(F):5'- TCAGAGACCTCCTGAGCCTG -3'
(R):5'- TTGCTGAAGGACCATGACACTACTAC -3'
Posted On2019-12-27