Incidental Mutation 'R7984:Ttc6'
ID615181
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57688567 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1132 (R1132W)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
Predicted Effect probably damaging
Transcript: ENSMUST00000172939
AA Change: R1132W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: R1132W

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7535:Ttc6 UTSW 12 57576519 missense probably benign 0.00
R7866:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7901:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R7949:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R8062:Ttc6 UTSW 12 57736978 missense possibly damaging 0.90
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57697375 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTTCCATTAACCCGTGAAC -3'
(R):5'- ATGGACTTACATTTCCTCCAAGC -3'

Sequencing Primer
(F):5'- TGCCACAGTATTACTAGTTAGCC -3'
(R):5'- TCTACAAAGTTATTGATAATGCGGG -3'
Posted On2019-12-27