Incidental Mutation 'R7984:Ell2'
ID615185
Institutional Source Beutler Lab
Gene Symbol Ell2
Ensembl Gene ENSMUSG00000001542
Gene Nameelongation factor RNA polymerase II 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75706757-75772364 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75763986 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 464 (K464*)
Ref Sequence ENSEMBL: ENSMUSP00000001583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001583] [ENSMUST00000220572] [ENSMUST00000222194] [ENSMUST00000222853]
Predicted Effect probably null
Transcript: ENSMUST00000001583
AA Change: K464*
SMART Domains Protein: ENSMUSP00000001583
Gene: ENSMUSG00000001542
AA Change: K464*

DomainStartEndE-ValueType
Pfam:ELL 11 291 2.4e-108 PFAM
low complexity region 362 401 N/A INTRINSIC
low complexity region 451 476 N/A INTRINSIC
Pfam:Occludin_ELL 531 632 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220572
Predicted Effect probably benign
Transcript: ENSMUST00000222194
Predicted Effect probably benign
Transcript: ENSMUST00000222853
Predicted Effect probably benign
Transcript: ENSMUST00000222892
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Ell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ell2 APN 13 75756290 missense probably damaging 1.00
IGL01315:Ell2 APN 13 75762232 unclassified probably benign
IGL01446:Ell2 APN 13 75761991 missense probably benign 0.02
IGL02691:Ell2 APN 13 75756486 missense probably damaging 0.97
IGL02963:Ell2 APN 13 75769643 missense possibly damaging 0.48
IGL03035:Ell2 APN 13 75763648 nonsense probably null
enhancement UTSW 13 75770735 missense probably damaging 1.00
stilts UTSW 13 75763986 nonsense probably null
PIT4469001:Ell2 UTSW 13 75761892 missense probably damaging 0.99
R0123:Ell2 UTSW 13 75762140 splice site probably benign
R0321:Ell2 UTSW 13 75761888 missense probably damaging 1.00
R0594:Ell2 UTSW 13 75749993 missense probably damaging 1.00
R0892:Ell2 UTSW 13 75763639 missense probably damaging 0.97
R1078:Ell2 UTSW 13 75746419 splice site probably benign
R1696:Ell2 UTSW 13 75769558 missense probably damaging 1.00
R2325:Ell2 UTSW 13 75769626 missense probably damaging 1.00
R2886:Ell2 UTSW 13 75763785 missense probably damaging 1.00
R3760:Ell2 UTSW 13 75762162 missense probably benign 0.37
R4206:Ell2 UTSW 13 75761948 missense probably damaging 1.00
R4632:Ell2 UTSW 13 75769574 missense possibly damaging 0.84
R5068:Ell2 UTSW 13 75763618 missense probably benign 0.00
R6980:Ell2 UTSW 13 75756376 missense probably null
R6983:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6984:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6986:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7073:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7074:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7473:Ell2 UTSW 13 75750035 missense probably damaging 1.00
R7590:Ell2 UTSW 13 75770735 missense probably damaging 1.00
R7901:Ell2 UTSW 13 75763986 nonsense probably null
RF018:Ell2 UTSW 13 75763608 missense probably damaging 1.00
Z1088:Ell2 UTSW 13 75761873 critical splice acceptor site probably benign
Z1176:Ell2 UTSW 13 75756452 missense probably damaging 0.99
Z1176:Ell2 UTSW 13 75770689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCCTAGCACTCCAGAAGG -3'
(R):5'- GCTCCTCCAGTTCATTTAACACAG -3'

Sequencing Primer
(F):5'- AGGCCTGGGGACTCAAGAC -3'
(R):5'- GTTCATTTAACACAGAAAGCAGGC -3'
Posted On2019-12-27