Incidental Mutation 'R7984:Olfr734'
ID615187
Institutional Source Beutler Lab
Gene Symbol Olfr734
Ensembl Gene ENSMUSG00000045306
Gene Nameolfactory receptor 734
SynonymsMOR242-1, GA_x6K02T2PMLR-6013665-6012724
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50316506-50326761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50320116 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 240 (S240T)
Ref Sequence ENSEMBL: ENSMUSP00000150732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050928] [ENSMUST00000217152]
Predicted Effect probably damaging
Transcript: ENSMUST00000050928
AA Change: S240T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057376
Gene: ENSMUSG00000045306
AA Change: S240T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-39 PFAM
Pfam:7tm_1 41 302 4.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217152
AA Change: S240T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Olfr734
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr734 APN 14 50320275 missense probably damaging 0.96
IGL01285:Olfr734 APN 14 50320256 missense possibly damaging 0.88
IGL02106:Olfr734 APN 14 50320160 missense probably damaging 1.00
IGL02313:Olfr734 APN 14 50320016 missense probably damaging 0.99
IGL03125:Olfr734 APN 14 50320692 missense probably benign 0.01
R0276:Olfr734 UTSW 14 50320179 missense probably benign 0.23
R0547:Olfr734 UTSW 14 50320118 missense probably benign 0.06
R0567:Olfr734 UTSW 14 50320658 missense probably damaging 0.99
R0927:Olfr734 UTSW 14 50320729 nonsense probably null
R1506:Olfr734 UTSW 14 50320484 missense probably benign 0.00
R4032:Olfr734 UTSW 14 50320310 missense possibly damaging 0.91
R5179:Olfr734 UTSW 14 50320536 nonsense probably null
R5401:Olfr734 UTSW 14 50320109 missense probably damaging 1.00
R6240:Olfr734 UTSW 14 50320586 missense probably benign 0.00
R7752:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R7901:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R8034:Olfr734 UTSW 14 50320566 missense probably damaging 1.00
X0064:Olfr734 UTSW 14 50320054 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACCACTTCCTGTGTTAGAAC -3'
(R):5'- TCACTCAGGTTGTCCGGATTG -3'

Sequencing Primer
(F):5'- ATATCTATTCACCAGCTTTCTCATGG -3'
(R):5'- CGGATTGCTTGTGCCAATAC -3'
Posted On2019-12-27