Incidental Mutation 'R7984:Gm5145'
ID615198
Institutional Source Beutler Lab
Gene Symbol Gm5145
Ensembl Gene ENSMUSG00000071273
Gene Namepredicted pseudogene 5145
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20570362-20571198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20570638 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 93 (I93L)
Ref Sequence ENSEMBL: ENSMUSP00000093293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095633] [ENSMUST00000169559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095633
AA Change: I93L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093293
Gene: ENSMUSG00000071273
AA Change: I93L

DomainStartEndE-ValueType
RRM 17 84 5.29e-5 SMART
low complexity region 101 113 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
RRM 207 274 1.55e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169559
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Gm5145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02350:Gm5145 APN 17 20570440 missense probably damaging 1.00
IGL02357:Gm5145 APN 17 20570440 missense probably damaging 1.00
IGL02587:Gm5145 APN 17 20571190 missense probably damaging 1.00
R3159:Gm5145 UTSW 17 20570893 missense probably benign 0.00
R3885:Gm5145 UTSW 17 20571010 missense probably benign 0.30
R4151:Gm5145 UTSW 17 20571098 missense probably damaging 1.00
R4583:Gm5145 UTSW 17 20570453 missense probably benign 0.02
R4798:Gm5145 UTSW 17 20570548 missense probably damaging 1.00
R7147:Gm5145 UTSW 17 20571061 missense probably damaging 1.00
R7297:Gm5145 UTSW 17 20570731 missense probably benign 0.00
R7627:Gm5145 UTSW 17 20570392 nonsense probably null
R7670:Gm5145 UTSW 17 20570384 missense probably benign 0.09
R7897:Gm5145 UTSW 17 20570705 missense probably benign
R7901:Gm5145 UTSW 17 20570638 missense possibly damaging 0.86
R7980:Gm5145 UTSW 17 20570705 missense probably benign
Z1177:Gm5145 UTSW 17 20571052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGAGCTCAAGAAGTCCC -3'
(R):5'- ATGTAGGGAGACTGTCCTAGC -3'

Sequencing Primer
(F):5'- TGAGCTCAAGAAGTCCCTGTATGC -3'
(R):5'- CCTAGCGTGTGATGCATGAC -3'
Posted On2019-12-27