Incidental Mutation 'R7984:Unkl'
ID615199
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Nameunkempt family like zinc finger
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25188397-25234443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25218653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 200 (S200P)
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015271] [ENSMUST00000039734] [ENSMUST00000160896] [ENSMUST00000161679] [ENSMUST00000162498]
Predicted Effect probably benign
Transcript: ENSMUST00000015271
SMART Domains Protein: ENSMUSP00000015271
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
coiled coil region 73 154 N/A INTRINSIC
RING 198 232 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039734
AA Change: S386P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127
AA Change: S386P

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160896
AA Change: S200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127
AA Change: S200P

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161679
SMART Domains Protein: ENSMUSP00000125294
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 15 31 N/A INTRINSIC
coiled coil region 65 146 N/A INTRINSIC
RING 190 224 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162498
SMART Domains Protein: ENSMUSP00000124530
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 51 83 N/A INTRINSIC
low complexity region 87 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25210848 missense probably benign 0.00
IGL02011:Unkl APN 17 25218591 missense probably damaging 1.00
IGL02141:Unkl APN 17 25229434 missense probably damaging 1.00
R0226:Unkl UTSW 17 25230711 missense probably damaging 0.96
R0394:Unkl UTSW 17 25230777 critical splice donor site probably null
R0638:Unkl UTSW 17 25208083 splice site probably benign
R1364:Unkl UTSW 17 25189623 missense probably benign
R1596:Unkl UTSW 17 25205733 missense probably null 1.00
R1899:Unkl UTSW 17 25229460 unclassified probably null
R1960:Unkl UTSW 17 25209645 splice site probably benign
R3774:Unkl UTSW 17 25188407 unclassified probably null
R3927:Unkl UTSW 17 25229329 missense probably damaging 0.99
R5164:Unkl UTSW 17 25213109 splice site probably null
R5481:Unkl UTSW 17 25201172 nonsense probably null
R5520:Unkl UTSW 17 25205610 missense probably damaging 1.00
R5559:Unkl UTSW 17 25205713 missense probably benign 0.00
R6267:Unkl UTSW 17 25231865 makesense probably null
R6296:Unkl UTSW 17 25231865 makesense probably null
R6883:Unkl UTSW 17 25230333 missense probably damaging 1.00
R6979:Unkl UTSW 17 25199916 missense probably damaging 1.00
R7752:Unkl UTSW 17 25218653 missense probably damaging 1.00
R7901:Unkl UTSW 17 25218653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTGTTATGGTCAGTTCG -3'
(R):5'- TGGCTTTTCTACAGAGCAGC -3'

Sequencing Primer
(F):5'- CTCTGTGACACCTGAACTGTTGG -3'
(R):5'- CGCAGCCTGAACATCCAC -3'
Posted On2019-12-27