Mutagenetix > Incidental Mutation

Incidental Mutation 'R0673:Blm'

61520

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

038858-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0673 (G1)

Quality Score

123

Status

Not validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 80499751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

probably null
Transcript: ENSMUST00000081314

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170315

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	C	T	17: 45,733,073	W86*	probably null	Het
2700049A03Rik	C	T	12: 71,177,868	P894S	probably damaging	Het
Adgrg7	A	T	16: 56,773,486	N122K	possibly damaging	Het
Ankrd13d	A	T	19: 4,273,019		probably null	Het
Caml	C	T	13: 55,631,828	T238M	probably damaging	Het
Casd1	T	A	6: 4,624,440	V411D	possibly damaging	Het
Cdc25b	A	G	2: 131,197,262	N516D	probably benign	Het
Cmya5	A	G	13: 93,089,997	I2861T	probably damaging	Het
Csmd3	A	G	15: 47,913,940	L1294P	probably damaging	Het
Cxxc1	A	G	18: 74,218,913	D287G	possibly damaging	Het
Dgkq	T	C	5: 108,655,589	H217R	probably damaging	Het
Disp2	A	T	2: 118,790,844	I686F	possibly damaging	Het
Dnah6	T	A	6: 73,123,811	N2003I	probably benign	Het
Dsc3	T	A	18: 19,989,590	R92S	probably damaging	Het
Ei24	T	G	9: 36,788,255		probably null	Het
Fgl1	G	T	8: 41,191,624	T281K	probably benign	Het
Gbp3	A	G	3: 142,565,254	T140A	probably benign	Het
Gtpbp3	A	T	8: 71,492,735	I485F	probably damaging	Het
Harbi1	C	T	2: 91,712,535	R114W	probably damaging	Het
Inmt	A	C	6: 55,171,227	V139G	probably damaging	Het
Inpp5j	T	A	11: 3,501,147	M501L	probably benign	Het
Jmjd1c	A	G	10: 67,226,809	N1647S	probably damaging	Het
Lgals9	A	G	11: 78,965,853	F252L	probably damaging	Het
Lingo3	C	A	10: 80,835,784	R104L	probably benign	Het
Lrrc8c	G	A	5: 105,607,678	V440M	probably damaging	Het
Mybpc3	G	A	2: 91,120,427	G36D	probably damaging	Het
Ncapd3	T	A	9: 27,087,477	N1254K	probably benign	Het
Neb	A	G	2: 52,256,124	V2947A	possibly damaging	Het
Nudt12	A	T	17: 59,007,622		probably null	Het
Olfr140	A	C	2: 90,052,252	M24R	probably benign	Het
Olfr167	A	G	16: 19,515,396	M80T	probably damaging	Het
Otop1	T	C	5: 38,287,948	V150A	possibly damaging	Het
Prr14l	C	T	5: 32,828,915	D1079N	probably benign	Het
Rasal1	A	G	5: 120,670,384	T494A	probably benign	Het
Sacs	A	G	14: 61,210,215	K3237E	possibly damaging	Het
Sh3d19	T	C	3: 86,106,973	S415P	probably benign	Het
Sypl	A	T	12: 32,965,421	T40S	probably damaging	Het
Tg	A	T	15: 66,741,484		probably null	Het
Tmed8	A	G	12: 87,174,104	V236A	probably damaging	Het
Vmn1r33	T	C	6: 66,611,799	Y257C	probably damaging	Het
Yme1l1	T	C	2: 23,168,288	F144S	probably benign	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCAGAGGCTGAGGTAACACACTTTC -3'
(R):5'- ACTCACTGTGTGCTGCTCACTG -3'

Sequencing Primer
(F):5'- GCTGAGGTAACACACTTTCTTACTG -3'
(R):5'- GGTAAGGCTAAACTATGTCACTGTG -3'

Posted On

2013-07-30