Incidental Mutation 'R7984:Csf1r'
ID615202
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Namecolony stimulating factor 1 receptor
SynonymsFms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R7984 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61105572-61132149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61110296 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 128 (L128Q)
Ref Sequence ENSEMBL: ENSMUSP00000025523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
Predicted Effect probably damaging
Transcript: ENSMUST00000025523
AA Change: L128Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: L128Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115268
AA Change: L128Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: L128Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61114825 missense probably benign 0.08
IGL01603:Csf1r APN 18 61129301 missense probably damaging 1.00
IGL02377:Csf1r APN 18 61124468 splice site probably benign
IGL03000:Csf1r APN 18 61109652 missense probably damaging 0.97
IGL03011:Csf1r APN 18 61110401 missense probably benign 0.00
IGL03132:Csf1r APN 18 61128099 missense probably benign 0.03
IGL03189:Csf1r APN 18 61105986 missense probably benign 0.05
IGL03224:Csf1r APN 18 61112062 missense probably damaging 0.96
IGL03351:Csf1r APN 18 61117108 nonsense probably null
ANU74:Csf1r UTSW 18 61117391 missense probably benign 0.09
R1245:Csf1r UTSW 18 61114812 missense probably benign
R1363:Csf1r UTSW 18 61124845 missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61110401 missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1786:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1902:Csf1r UTSW 18 61130141 missense probably damaging 0.99
R1968:Csf1r UTSW 18 61112795 missense probably benign 0.00
R2177:Csf1r UTSW 18 61114943 splice site probably benign
R3743:Csf1r UTSW 18 61114774 missense probably benign 0.01
R3809:Csf1r UTSW 18 61112764 missense probably benign 0.22
R4374:Csf1r UTSW 18 61119006 missense probably damaging 0.99
R4683:Csf1r UTSW 18 61124911 missense probably damaging 1.00
R4973:Csf1r UTSW 18 61129047 missense probably damaging 1.00
R5080:Csf1r UTSW 18 61124301 missense probably damaging 1.00
R5314:Csf1r UTSW 18 61129724 missense probably damaging 1.00
R5936:Csf1r UTSW 18 61125808 missense probably damaging 1.00
R6015:Csf1r UTSW 18 61109712 missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61125828 nonsense probably null
R6505:Csf1r UTSW 18 61129733 missense probably damaging 1.00
R6602:Csf1r UTSW 18 61110425 missense possibly damaging 0.81
R6811:Csf1r UTSW 18 61119053 missense probably damaging 1.00
R6813:Csf1r UTSW 18 61112734 missense probably benign
R7218:Csf1r UTSW 18 61130324 missense probably damaging 1.00
R7480:Csf1r UTSW 18 61117538 missense probably benign 0.06
R7752:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R7762:Csf1r UTSW 18 61110500 missense probably benign 0.01
R7901:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R8012:Csf1r UTSW 18 61117064 missense possibly damaging 0.86
R8043:Csf1r UTSW 18 61124875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGTAGCAACAAGGGC -3'
(R):5'- GGTGGATTCCCTACCATTCAC -3'

Sequencing Primer
(F):5'- TCTAGAAGCCAACCTGGAATGGTC -3'
(R):5'- ACCATGGTCTTGCACACGTAG -3'
Posted On2019-12-27