Incidental Mutation 'R0673:Gtpbp3'
ID61522
Institutional Source Beutler Lab
Gene Symbol Gtpbp3
Ensembl Gene ENSMUSG00000007610
Gene NameGTP binding protein 3
Synonyms2410009F13Rik, Gtpbp3
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0673 (G1)
Quality Score141
Status Not validated
Chromosome8
Chromosomal Location71488103-71499583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71492735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 485 (I485F)
Ref Sequence ENSEMBL: ENSMUSP00000126761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847]
Predicted Effect probably damaging
Transcript: ENSMUST00000007754
AA Change: I484F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610
AA Change: I484F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect probably damaging
Transcript: ENSMUST00000150969
AA Change: I484F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610
AA Change: I484F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168847
AA Change: I485F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610
AA Change: I485F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Gtpbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Gtpbp3 APN 8 71490434 missense probably damaging 1.00
IGL02476:Gtpbp3 APN 8 71492598 missense probably damaging 1.00
IGL02669:Gtpbp3 APN 8 71490902 missense probably damaging 1.00
IGL02885:Gtpbp3 APN 8 71489420 unclassified probably benign
IGL03038:Gtpbp3 APN 8 71489303 missense possibly damaging 0.94
R0267:Gtpbp3 UTSW 8 71491497 missense probably damaging 1.00
R0442:Gtpbp3 UTSW 8 71491491 missense probably damaging 0.97
R0639:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R1844:Gtpbp3 UTSW 8 71492628 missense probably benign 0.05
R1957:Gtpbp3 UTSW 8 71490455 missense probably damaging 1.00
R2996:Gtpbp3 UTSW 8 71489496 missense possibly damaging 0.69
R3703:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R3705:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R4084:Gtpbp3 UTSW 8 71490512 missense probably benign 0.00
R4181:Gtpbp3 UTSW 8 71491467 missense probably damaging 1.00
R4705:Gtpbp3 UTSW 8 71491114 missense probably benign 0.23
R5081:Gtpbp3 UTSW 8 71490382 missense probably damaging 1.00
R5260:Gtpbp3 UTSW 8 71489418 unclassified probably benign
R5619:Gtpbp3 UTSW 8 71491048 intron probably benign
R5844:Gtpbp3 UTSW 8 71492555 missense probably benign 0.01
R6666:Gtpbp3 UTSW 8 71490938 missense possibly damaging 0.61
R7092:Gtpbp3 UTSW 8 71492265 missense probably benign
R7295:Gtpbp3 UTSW 8 71489495 missense possibly damaging 0.81
R7532:Gtpbp3 UTSW 8 71489463 missense probably benign 0.00
X0013:Gtpbp3 UTSW 8 71492693 missense possibly damaging 0.77
X0021:Gtpbp3 UTSW 8 71490517 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ATCTGATCTGCTGTCTGCTAATGCC -3'
(R):5'- GGTGATGCTGACCTTAATCCCGAC -3'

Sequencing Primer
(F):5'- AGGTCTTTTTCCAAAAGTGGC -3'
(R):5'- GGTGAGGAAGTATCCACTGTC -3'
Posted On2013-07-30